| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGACUUCCUGCCCCUGCUCUGCACUCUCAGGUAUUCCCUGCUCUUACUC… | 436 nt | 0.6261 |
PHGR1 is a predominantly cytoplasmic protein highly expressed in colon (Oltedal et al., 2018). [supplied by OMIM]
A study in humans developed a multiplex RT-PCR assay for rectal mucosa identification, where the PHGR1 was positive in 19 out of 19 rectal mucosa samples and demonstrated a positive correlation with ZG16, though it was detected with slight peaks in 2 out of 10 semen samples, with a normalized peak height cutoff set at >0.1 [Akutsu et al. DOI:10.1016/J.Fsigen.2022.102712]. Another comparative study of mRNA-based methods noted the PHGR1 is mentioned in the literature as a useful marker for rectal mucosa [Martin et al. DOI:10.1016/j.fsigen.2025.103297].