Basic Information

Symbol
PHKA2
RNA class
mRNA
Alias
Phosphorylase Kinase Regulatory Subunit Alpha 2 PYK Phosphorylase B Kinase Regulatory Subunit Alpha, Liver Isoform Phosphorylase Kinase Alpha L Subunit PHK Phosphorylase Kinase Alpha-Subunit GSD9A PHKLA PYKL XLG2 XLG
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses

MANE select

Transcript ID
NM_000292.3
Sequence length
5077.0 nt
GC content
0.5155

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1753.00 kcal/mol
Thermodynamic ensemble
Free energy: -1835.76 kcal/mol
Frequency: 0.0000
Diversity: 1619.25
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((((((.(((((...((((((..((.(((.(((....))).))))).)))))).)))))((((.(((((((...((((((((.(((...((.((((((..(((.((.(((((((((((.(((((((((..(.(((((....))))).)..))))).)))).)))))((((((((((((((.((((.(((((((.((.....((((((((....))))((..(((((.((.((((.......)))).)))))))..)).....))))...(((((((((((((.(((...((((.((...(((((((.((((((........))))))..))))))).)))))).(((((.(((((..(((((((.(((.((((.((((((((((.(((((...(((..(((((((((((((...((((((.(((((((((.(((((((.((((.(((((((.(((.((.((((.(((((((...((((..............))))....((....(((....)))....))..............(((((((((((.((.((((.(....).)))).))..)))))....))))))..))))))).)))).))....)))..))))...))).))))(((...)))...))))))).)))).(((.....))).((((.(((.(((((.....((((((((((((((.(((.((.......)).)))..))))).....(((.((((((((((..(((.((..(..(((((((((((.(((....)))..))))..))).((.(((((......)))).).)).........((.(((((((((((((..((((((..((........))..))))))..)).))))).)))))).))...)))).)..)).)))..)))))))))).)))..((((((((..((....))..))))))))(((((((..((.(((((...((((((.((....)).).))))).............(((((((.((((((..((((...)))).......(((.((.((((((.((((.(((((((((((.(((.(........).))).))).))))........)))).)))))))))).)).))).(((((.....(((((.....)))))..)))))........)))))).))))))).))))).)).)))))))...(((((((...(((((........)))))((((((((((((((((((..(((((.(((.(((((.....((......))...)))))....(((((..(((........)))..)))))))).)))))......))))).(((((((((..((((....((((((((((((.......((((((.......(((((.((((((((((..(.(((..(((((((((((..(((((...)))))....)))))))......((((((((....(((((((....((((((((.((((......))))((((((.....))))))...))))).)))....))))))).......(((((((.((((.((...))..)))).))))))).......((((....)))).((.(((((((((((((((......((.(((((.((..((((.((((.(((((((.(((....)))..))))...))).)))).))))...))))))).)))))))))))))))))))))))))))...........(((((((.((....((((((...(((((......(((......)))......)))))))))))..))...))))))).....))))))))..))).))))))))))))....))))))..))))))))))))..(((...((((.(........)))))....)))))))..)))))))))...(((((..((((....))))..).))))((((((((.....))))))))....)))))..))))))))......)))))))...(((((((.((.((((((((((.((((((.(((((..............)))))...)).)))).))))(((((...)))))..........)))))).)))))))))...))))))))).))))).....))).)))).........(((........)))))))).))))))..)))...))))..))).)))....)))))))).)))).....(((.((((((......)))))).)))....(((((((.(((((((......)))))))..((((((..((..(((..((((...))))......))).))..)))))).......((((.((((((...(((((.......(((((.....))))).....(((((((...(((..(((((..((((.((((((((..(((..(((((((.(((((((....))))).(((((.......((((((((((((...)).)))))).)))))))))......(((((...)))))....(((((((...)))))))(((((....))))).....)))))))))....)))))))))))..)))).)))))))).)))).))).)))))....))..))))))))..)))))))))))))))))..)))....((((((((.((((((............))))))..))))))))....((.(((((((.......))))))).))...)))))))....))))).)))))(((((..((((.(((((((..(((((..((((((((((.(((.....(((......)))((((((((((((((((((((((((((((((.(((.((((((((((((((((.....)))))).((((((.((((...))))(((((((((.(((((.........))))).......((((.(((((((((..((((((......)))).))..))))))).)).))))..)))))))))...(((((.((((......))))..)))))))))))...)))))))))).((((.......))))....((....(((((............)))))...))((((((((..............(((((((.......)))))))(((((.((....(((.......)))..)).)))))...........))))))))............)))...))))))..)))))))))).((((.......)))).(((...)))((.....)).((((.....((((((....)).))))....))))....)))).))))))))))...((.((((((((.((.(((((((((.(((((((.((((((((..((((((.((.((((((..(((((((..((((((....(((((((...((((((((...))))))))....((((((.......))))))......(((.(((((((.((((.((.(((..((((((((.((((((((......)))).))))....((((((.(((..((....))))))))).))....(((((........)))))((((((((.....)))..)))))((((((...)))))).(((((((......(((.((....))))).....)))))))))))))))...)))))))))..)))))))))))))))))..)))))).)))))))....(((((((((...((....))..)))).)))))..........)))))).))..))))))...((((....(((((.(.(((.(((((((((...((((((.((((...........(((.((((...((...(((.((((....((.((((.....)))).)).((((.(....).))))..)))).)))...))...))))))).....))))))).)))...))))))))).))).)...)))))....))))......(((((((((........((((((.(((((.....))).)))))))).)))))))))))))))))...))))))))))))....(((.((((((.(((((.((((((((((((((((.......)))))))...)))))....)))).))))))))))).)))..((..(((....)))..))..))).).)).)))))))).)).........))).)))))))).).)..)))))....((((.(((((......))))))))))))))))(((((.....((((((....))))))))))).((((.....))))....)))))))))))))))))))))))))(((((((((.((..((((((((((((((....(((((...................)))))....)))))))...)))))))..)).)))..)))))))))))))))(((.....)))((((((......((((((.((((.((((...........((((..(((.....)))..))))...........((((((((((..((((((.(..(((((((....)))))))..).)))))).(((((((........)))))))...............((((((...))))))....................(((.((((...(((((((((((....))))))..))))).....(((..((((((....))))))..)))(((((((((.((((...))))..)))))....)))))))).))).)))))))))).)))).)))).)))))))))))).......)))).)))))).)).......))))))(((((.....)))))))))))..))...))).....))))))))...))))))))))).......)))))))))))(.(((((((.....))))))).))))))))..............(((.(((((.(((((((...)))))))..))))).)))..((((.....))))((((((((((((...((((((...((((((....((....))......))))))............))))))))))).))))))).
Thermodynamic Ensemble Prediction
{{{,(((.,,{((|,.{((((((,,,.{,,.,{,...,)))|}}|,,,|{{((((||{{{({,,,(,,,,||...||,|,,||||}.|||,||||||{,.,{{(,{{{((((,,(((((.(((((((((..(.(((((....))))).)..))))).)))).))))),,||||((((((,,{,,(((((.(.((({....})).,}.})}}}.{{({.((((((,((.(((((((((((({..,,,,{(((||...,,.....,|||.}}})))|,|}}}}|,.|))}}}}.||{((({(((((((,{((((({,{((({,.|,,,,...))))))){(({,,,.,,|||}(((((.((((((.({,{...,.({(.....))}.}|,}}...}})))}..))))},{,{{{{{{(({{,.,((((((..(((((((.(((((((((((((({(,,.{.((..(((((((({{((((((((((.((((...{{((...((((..(((((((({,(({,,{(,,...||......((((((((........))))))))|,.,,.,.,,|||((((((....((((.(((..............))).))))....)))))).{(({,.,(({...))).....},}}..........((((((.(((.((({.{,{.((((.((.{{((((...{....((((((((((((..({.({(((,,{,((({,.(((.((((((((((..(((.{,....((.(((((((((.(((....)))..))))..))},)).))..(((((,{{,|,,|.|,..,...,..((.(((((((((((((..((((((..((........))..))))))..)).))))).)))))).))..})))).}..},.)))..)))))))))).)))..((((((((..((....))..))))))))(({......))),.....{{{..{(((((,{.,({((((((((((.{....{{((,{((((,,.,{{....,|,...}}})),}}}}...(((,((.((((({{((((.(((((((((((.(((.{........}.))).))).))))........)))).)))))))))),)).))).(((((.,,..(((((.....))))).,)))))((((((((((((((((.,|{{{|||,...{|||||||{,.(({{{.,,,,}))},,,,,))))}}}}})))....))))){{{((((((....(((((((.((((({...{((,,{{..,|}|,||||,.{{(((,{,,{((,..,{{,.}},,}))})}}|.})|)),}..(,{{{{((.{((((({(,{.(((....((((((((.,(,((({{,....})))))}..))))))))....})).}}),)))))}),},},})))))))))))).)))))))......)))))}.....,.}.)))))))))){({(,.....}})},{{,{{.,.}},.,|},|{(({{{.,,..}}}})}...,,,....(((((...{({(........(((((((.((((.(,...,)..)))).)))))))..))))))))).)),)))},)))}}}))))),)).)))))))..)))))....,,...)))},}}.)).)))).},)))).))).))))))......)))))))))))...))))........}))).,}..))))....)))))))))}......,{(((((.{(,,,,((((((...(((((......(((......)))......)))))))))))..)).},)))))))}).)))))).)),.}))))))))).)}}(((....)))......,}))),..)))))))..)))))))}}}.,....,,,|)}}}}}.))))).)))))))))))))}}}}....{{{....}}}{{(({(((,,{(((((({{{{.|||||}}.....{(((,...((((((((..((((.((((.(((......(((.((((...((((.(((({{.({{{(.,,,.,..,,,},,}}}}}...,,.)))).}))}(((((...))))).))))))).....))).))))})))..))))))))...)))},..{{{,{...{.,..{.,...))))|,,,,,....,...{{{{{{{((....,,.....{{{((((({{{{{{{|{||,|{{{{|{{..,..(((.((((((......)))))).)))....,||||,{,(({((({,,,,,,||}}|}}.{((((((.,((..(((..((((...))))......))).)).,))))))},,.,,,}}|,..,||||,,.,,||....,|,,(((((.....))))).,{,{(((((({,..,{,.,(((((..((((.((((((({..(({,.(((((((.({(({({.,,,|}||}.{((((....,,.(((((((((({{...,}.))))))}}}))}}}}},.....(((({...)))))....,{{{{||,,,))}}}))(((((....))))).....}))))))))...,)}}})))))))..)))).)))))),},|{{(((({{{.{({{,,,{|.{||||,.,||.}|||}||{{{{{{{.,,........)))))))||}}}.||,.,...(({.((({{{{,,..,}))))),}}},|{}|{||||||...,,,}}))}))}))}},}|||,||{{{{|{,|,.{{|||((((({.,,...||||{(,{{.((({..,.,,||)),)},},.....(((......)))((((((((((((((((((((((((((((((.(({.((((((((((((((((.....)))))).{{{(((,((((...}}}|(((((((({.,{|||.,,,,,...}}||}....,,.((((.(((((((((..((((((......)))).))..))))))).)).))))..}}}}}}})),|,{{{{{.{{{{.,,...)))),,))}}})))))}...)))))))))).((((.......))))....,,....(((((............)))))...},((((((((..............(((((((.......)))))))(((((.((..,,({,......,)}}..)).)))))...........))))))))............}}}...))))))..)))))))))).((((.......)))),(((...}}}{{,,,,.}}.((((.....((((((....)).))))....))))....)))).))))))))))..{{(.(((({,,...,}|}}||||.,.,,,,,||}}||||||,}}||||||.||}||||||}.||||||}.}|||,|}}}}}||||,||}}}((((((((...))))))))..}}|||}}|}|||,..}}))))}},,..|{{{(((((||.||||,||.|||}.|{|||{,,}|||||||,.,..}})))).},}|{{,{{(((((.{{((((.{{{{{{,|||,,,{{.{{{(((((((...({{((((((((((((((,,,..}|},.}}}))(((({{..,)))}||{{((((((,,|||,|((,{(..||||},|,,{,.}}}}}}}}}}})}})}},)}}))))},,.)))||,||||||||||,..,},)))}})}})))}.},{|{{|||||...,|,},})},,},|||||}||,{{{{{{{{{||||,|.||..||||||..,{({{....({(((.(.(((.(((((((((...((((((.((((...........(((.((((...((.,.(((.((((....({.((((.....)))).)).((((.(....).))))..)))).)))...))...))))))).....))))))).)))...))))))))).))).|,..}}|)},,,,}|||...{{{({{{{{{||,,......((((((.,,{({.....))).)})))))).})))}}}}}|||||||{...}||||||,||||...{((.(((((({{((({{{((((((((((((((((.......)))))))..,))))}..,{||||{|||||{|{,|||||{{{({{{(,({{{{||,{{{|,{{||.,{,{{{{.||||{{|,.,,......,,,})))))),)})}.}.}})}},..,((((.(((({......}))))))))})))),,|}|||}},}}|.||||},..))),,))))),.{,(({..{(((((({....,..((((({.((|{(,,(((({....|}))}..|,..{{((((((({((({,.{{({(((,..................))))}.,,.})))))),,.)))))||,.||{|||,{|||,||||||||,|{((,.{{{{{{{(,{(((......}||,|.}||||.,,||}.}},,,,....,,{.|{|,..,,})},..)))},,,,,,,.,,,{,,,(((((((.((((((.(..(((((((....)))))))..).)))))).))))))|......}}))))))))}.......}}}}}}||,,||,,,)))))),,.............,,|,.|{||||||...{{{{{,(((((....)))))}..}}})},,},,{{|,,|{((((,...||||||,.,,,|||||||||,||{,...}))),,)))))}}},)))),.,)))))))))))))))}.},,}.},)).}))})}}}}}}},,..,,})))),)})}}}||}......,||||}}(((({.....}))))}||}}}.,}}...}}}|,,|,,}}}))},}},})}}})}))))))...)}))),)))))))}}),}||)}.))}})))))),))))),)))}}}.}}}}.}},.}|||,{||||}((((((,...,))))))..))))),)},..((((.....))))((((((((((((...{{((({...(({{{{....{{...,)}......})))))............)))})})))))}}}))))).

Transcripts

ID Sequence Length GC content
GCUUUCCAACCGGACUUUGGGGCUAGCGUUUAGAAAAGUCUCGACCUCC… 5077 nt 0.5155
Summary

Phosphorylase kinase is a polymer of 16 subunits, four each of alpha, beta, gamma and delta. The alpha subunit includes the skeletal muscle and hepatic isoforms, and the hepatic isoform is encoded by this gene. The beta subunit is the same in both the muscle and hepatic isoforms, and encoded by one gene. The gamma subunit also includes the skeletal muscle and hepatic isoforms, which are encoded by two different genes. The delta subunit is a calmodulin and can be encoded by three different genes. The gamma subunits contain the active site of the enzyme, whereas the alpha and beta subunits have regulatory functions controlled by phosphorylation. The delta subunit mediates the dependence of the enzyme on calcium concentration. Mutations in this gene cause glycogen storage disease type 9A, also known as X-linked liver glycogenosis. Alternatively spliced transcript variants have been reported, but the full-length nature of these variants has not been determined.[provided by RefSeq, Feb 2010]

Forensic Context

A study in mice demonstrated that chronic cocaine exposure and withdrawal induced a sustained increase in the expression of phosphorylase b kinase alpha 2 (Phka2) in the nucleus accumbens, as part of a broader dysregulation in heterotrimeric G-protein signaling pathways [Eipper-Mains et al. DOI:10.1111/J.1601-183X.2012.00873.X].