Basic Information

Symbol
PHLDA1
RNA class
mRNA
Alias
Pleckstrin Homology Like Domain Family A Member 1 TDAG51 PHRIP DT1P1B11 Pleckstrin Homology-Like Domain Family A Member 1 T-Cell Death-Associated Gene 51 Protein Apoptosis-Associated Nuclear Protein Proline- And Glutamine-Rich Protein Proline- And Histidine-Rich Protein Proline-Histidine Rich Protein PQ-Rich Protein PQR Protein Pleckstrin Homology-Like Domain, Family A, Member 1 T-Cell Death-Associated Gene 51
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis Sudden death from CNS diseases

MANE select

Transcript ID
NM_007350.3
Sequence length
5913.0 nt
GC content
0.4296

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1814.10 kcal/mol
Thermodynamic ensemble
Free energy: -1919.61 kcal/mol
Frequency: 0.0000
Diversity: 1479.14
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((.((((..((((((((...))))))).........)..)))).)))(((..(((.(((.((....)).))).)))...((((((((((((........((.((((.((((((((((((((...))))...)))))))))).))))))........)))))))).))))((((((((.((((...(((((((((....(((((((.(((((((((((((((.((((...))))))))).))))((((.((....(((.(((((((((((......)))))....))))))(((.(((((.((((((...((((((.((......))))))))...))))))))))).)))(((((.((((((((((((...(((((.(((((..((....))...))))))))))((((((....((((.((((..(((....))))))).))))...((((((.(((((((((.(.((.(((((((...((.(((((.((.(((.(((((((((..((((.(((.((((((((((..((((((..........((((((.(((((...)))))...(((((((((......((....)).(((((.......))))))))))))))....))))))....))).)))..))))))))))((((((((..(((...((((((...((((((((((((((((.((((((((((.((((..........)))).)))..((((.((((........))))...)))).))).))))))))...))))(((((....)))))))))).)))))))))...(((((..((((.....))))..)))))((..(((((((((((....((((.......((((((.....))))))......(((((((((....)))))))))..........))))........)))).)))))))..))....))))))))....))).....))).).)))..)))))))....)))))..)))))))))))))))).))))))))....))).)...)))))).))))))..........)))).)))))))).))))).......)))))..)))).........................((((..(((((..(((((...((....))....((..........))............(((((..((((........))))...)))))..(((.(((.((((....((.((((((...((((...))))))))))))...)))).))).)))..)))))..))))).))))(((((((.....((((((..(((((((..((((((...(((..((..(((((((((.(((..(((((((((((.((((.(((((..(((((.(((((((((......(((((((((((.............)))))))))))......))))).(.(((((..........((.((((...)))).))))))).)...)))).))))))))).).)))).(((((((((((((((((((..(((.(((((((((((((((........(((((..((((((((((((..(((((((.((((((............(((((.....)))))..............(((((((....(((((..(..((((((.(((........((((((((((((((.((((((....(((..(((((..........)))))..))).((((((.....))))))...(((((((.......(((((((((....(((...((((((..((((((((((((((((..((((((((((((((((...(((.....)))...)))))...))).)))))............)))..))))))))).....)))))))..((((((....)))))).))))))...)))....)))))))))..........)))))))......((((((((((..(..((.(((((((((((((((...))))))..)))).)))))..))..)..)))))))))).((((((((((..(((.....(((((.((((((((((((.(((...((((((........))))))....)))..))))))....(((((.(((...(((((((..((.(((......)))..))..)))))))...)))...))))))).))))))))))))..))))))))))...............(((((((((((((...(((((((((((.......))))))......(((((.......)))))............)))))....)))......(((..(((((((((...))))))))).)))))))))))))......)))))).))))))))))))))........))).))))))..)..)))))))))))).........(((.....)))...((((((((.((((..((((((((((((((.....)))))...((((((.(((.((..(.(((...))).).)).))).)...))))).....(((((......))))).(((((.......))))).))))))))).........((((.......))))....(((((((.((((.((((.......(((((((((((.((((....((((((...))))))....))))))..........))))))))))))).)))).)))))))))))...)))))))).))))))))))))).))..........))))))))))..)))))((((.......)))).......))))))).)))))))).))))))))))))))))).).))))....((((....((((((.(.....).))))))....)))))))))))))))))).))))...........(((.(((((.(((..........)))))))).)))...((((((.(((...))).))))))....(((((((((((((.(((((.(((((((((....))))))...((((((((((.((..((.(((((((.....((((((.............(((((((((((((((((((((((((((((((((((.((((.(((((((...((((((((((....))))))))))...))))))).)))).)))))))))))))))))))))))....))))))))))))((((((((((((.((...((..(((((....))))).))..)).)))))..)))))))(((((...(((((....))))).)))))............))).)))..))))))).)).)))))).)))))).......(((....)))((((((((((((...............))))))))))))....................((((((((......))))))))..)))...))))).))))))))))))).....)))))..))..)))...))))))(((((((....((..((((.((....)).))))))...)))))))....(((((((((((((((((((((.....((....))))))))))))......................((((((...))))))...(((((((((((.((((((((((((((.((....)))).)))))))..)))))...)))))).))))).(((((.(((((((((((..(....)..))))))))...))).))))))))))))...(((.(((....(((((((((.((((.(.((((...(((((...(.(((((((..(((....))).))))))).).))))))))))))))((((((((.....)).)))))).(((((((((.(((((((.......(((..(((((....((((....)))))))))..))).(((((..(((((((...((((((..............)))))).(((((((((((.....((((((.((((......))))))))))..)))).)))))))..((((((.((((((((........(((((((((...)))))))))..))))))))))))))..............)))))))....)))))....((((((.....))))))........))))))).....))))))))).................((((.........((((((.(((....))))))))).......)))).)))))))))....))).)))...)))).)))))))..))))))((..(((((......((((...))))....((.(((((.((((....)))).))))).))..........((((((((((.......((((.(((.....)))..))))(((((..........))))).))))))))))))))).))...)))))))....(((((((...))))))).)))))))))))))...(((((((((.....(((.(((.(((((.(......).))))).))).)))..(((((.(((((((((...((((((.............(((((((((((((((...(((((........))))).(((((.((((((((((((..........))))(((((.(((((((...)))).....))).))))))))))))).)))))....((((..((((...((.(((((...............)))))))....(((((.((.((((((((((((.(((((......))))).)))))))))))))).))))).......))))..))))...........)))))..))))))))))((..(((((((((......)))))))))..))...(((((((((.............((((((((((((.....))))))))))))................((.((((((...)))))))).)))))))))..........(((((((...........)))))))...))))))....)))))))))..)))))..........)))))))))..((.((((.(((((.(((((.((((.((((....(((.........(((((((((.(((.(((((((.(((((...........)))))..)))))))((((((((((((....)))))....(((((...((((((...(((....)))...))))))...))))).........((((((((((((.....))))))..)))))))))))))........((((.(((........))).))))....))).)).)))))))((((((((.....))))))))))))))).))))))).)).))))))))).)))))))))))...))))))))))))......((((((((((((((....))))))))(((((((....)))))))...(((..(((((((((........(((((((((((..(((((((((((......(((((....)))))..........(((((..(..((((...))))..).)))))........((..(((((((.(((((((((((((.((.((((.........))))..)).))))))))))).)).)))))))..))..)))))))))))..))))).)))))).(((((((((.......(((........)))........(((....)))))))))))).............))))))))).)))))))))..((((((....((.((.((((..((((........(((.......)))........)))))))))))))))))).......((((((.((((((((((((..((((((.(((.((((((..........)))))).))).))))))...))))))))))))..)))))).))).
Thermodynamic Ensemble Prediction
(((.((((..((((((({...})))))).........)..)))).)))(((..(((.(((.((....)).))).)))...((((((((((((........((.((((.((((((((((((((...)))),..)))))))))).))))))........)))))))).))))((((((((.((((..,((((((((,....(((((({{(((((({((((((((.((((...))))))))).)))|((((.({....((..(((((((((((......)))))....))))))(((.(((((.((((((...((((((.((......}}))))))...))))))))))).)))(((((.((((((((((((.,{(((((,(((((..((.,..|}...})))}}))||((((((....((((.((((,.(((....))))))).))))...((((((.((,,(((((,(.{{.(((((((,..,(,((((.{((.((({{(((((((({{(,(({(((,(((((((((({,(({(({.........,{|||||.(((((...))))).,.(((((((((......((....||.(((((.......)))))}))}}},}|....))}))},}.}}))}}))..}}))}||||(((..((((,,(((...))))))))..))).|{|||..,|||}}}}},,,(((.({{(,,,.,,....}}}}.}}}..||}}.|}||}}},.,,{{||{..||||,||||,||||,,}|,..|,}}||||.},}}},))))}||||}||,}}})),}.(((((.,((((.....})))..)))))((..(((((((((((...,((((.,.....((((((.....))))))....{.{((((((((....)))))))))}.......,.))))....,,..)))).)))))))..))}))))))).))),.)))}})}...,))})))))..))))))).},..,))),,),}}}}}})))))))).,},}}}))....,,}.,...}}))))}))}))).........,)))).)))))))).)))))..,,...,.}))..)))),........................((((..(((((..(((((...((....))....{{..........}}............(((((..{{{{..,,....}}))...)))))..(((.(((.((((....,(,((((((...((({...)))}))))))}),..)))).))).)))..)))))..))))).))))(((((({....,((((((..((((({{..{{(({{...,{{..{{,.(((((((((.{{{..{((((({{(({.,.{{|{{||||,||,,,.,|||{({{{{{{,,{(((((((({{,.{,,,...,,{,.||||||||}}|{{,,,.(((((...,,}}}}}...,,,.,|,.,,|,,}}}}))))))))}})))},))))..,,,,||{{{|{||||.{((({((((((((((((((..(((.((((((({(((((({........(((((..(((((((((({(..(((((((.((((((,..,,,,...,,(((((.....)))}}.,,,,,........{{{{{{,....||{{{.,|..{{{{||,|||,,......((((((((((((((.((((({....(((..{{{|{.....,,,,,||||}..|||,({{(({,,,.,||}}}}...{{{|||{|||,,{{((,||,....,}}||||.....,((,.,{{{|||{((((((((((((((((({{{((((((...(((.....)))...)))))},}))).})))}.})))}}},{,{,.,..,}}}}}}}}..,,,)}}||||.,||,{{,.....(((((((({{,,....,,)}.})))))))............}||}}}|{,....{{{{{{((((.,{..{|,|||||{{{(((((((...))))))}..}}},||||,..,},,),}}}}}}})}}}.(((((((({(,{(((.....(((((((((((((,{,{{{(({...{,((((,,{{,,{,,|||}},.,,|||,.}||,},.,}.,||||,{{{...(((((((..{{.(((......)))..))..)))))))...))),,.},}}))).))))))))),,)}})))))))))).,||,,|,,..,...{((((((((({{({{((,((((,{,..{({{{.,{,((......,,}}}))))..,,.)))}...)})},....,}}}})}}..}})|||,..,||,.{((((((({...}))))))}}.}},)))))))))}......)))))).))))))))))))))........}}).)))))}..|..}}|||}}}}))}.,,}.,...}}}}},.,}}},,,((({(({{{(({,..{{({(((({|{(((.....))))},..((((((.(({.((..{,({(...}}}.}.)).))).}},,})))).....{{({(,...,.))))}.{((((.......))))).))))))))).........((({.......)))).,,,{((((((.((((.((((.......(((((((((((.((((....((((((...))))))....))))}}..........))))))))))))).)))).))))))})))},,.}))))))}.))))))))))))).}},.......,.))))))))))..)))))((((.......))))..,....})))))).)))))))).))})))))))))))))).}.))))...|||{{,...,(((({{{.....}|}})))),,,,.||||}}}}}}}||||||,}}||,,,.,,.....{{{.{{{((.({{......,.,.}}}}}}}}.})},..((((({.,,,...|}|.}})}}},{{{(((((((((((((.(((((.,,.((((((....))))))...(((((({{((.((..((.(((((((...,.((((({......,,,,,,.(((((((((((((((((((((((((((((((((((.((((.(((((((.,.((((((((((....))))))))))...))))))).)))).)))))))))))))))))))))))),.,})))))))))))((((((((((((.((...,{..(((((....))))).}}..)).)))))..)))))))(((((...(((((....))))).))))).....,,,,},.))).)))..))))))).)).))}))}.)))))).,.....{{{...,||}((((((((((((...............))))))))))))...,,,.......,,.....{{{{{{{{......)))}}}},..}))},.))))).))))))))))))).,,,.))))}.|)},.}}}...))))))|||||||...,||}.||||}|,|||.))|)},||},..|||||||{,,,(((((((((((((((((((((.....((....))))))))))))......................,(((((...)))))}...,((((((((((.{(((((((((((((.((....)))).)))))))..)))))...))))))}})))}.(((((.(((((((((((..(....)..))))))),..}))).)))))))))))))...))).||.{((((((((,{{.((({.{.((((...(((((...(.(((((((..(((....))).))))))).).)))))})))))))}((((((((.....)).)))))).{((((((((,(((((((.......(((..(((((....((((....)))))))))..))).(((({..(((((((,,.(((({,..............}}})}}.(((((((((((.....((((((.((((......))))))))))..))))))})))))..((((((.((((((((........(((((((({...}))))))))..))))))))))))))...,,.,,......))))))),,,.,}}},.,,,((((((.....)))))).}}}....))))))).,...}))))))))..,},.))}}))}},.,|||...,......((((({,(((....))))))))).,|||{{}}||,.....|||.||||||..,,}}}})))},)))))))..)))))){|,,||||{......((({...})))....||,{||||,||||,,,,}))).||||}.},},,..,....((((((((((..,,{.,((((,(((.....))).,||}}|{{||,,,,,,,,,.,,,)),)))))))))))))}},))},,}))))))....{((((((...))))))).)))))))))))))}}}||||||,{{,,,..{((.(((.(((((.(......}.))))).))).))|..(((((,((((((((((..(((((({,,{{,,......((((((((((,(((({....|||||.{(((((.(((.(((((.((((((({{(((..........)))}((((({{{{((((...}))),,,..,,).}))))}))))))).))))).))).)))}},|{|,,.|{,{{{{{..,,.....,,....,}}}},.....{((((.{{.((((((((((((.(((((......))))).))))))))))))}}.))))),,,,..,|||,,.,,}}|..,,.|,...})))),.)))))))))}{{..(((((((((......)))))))))..},...(((((((((...,,.....|}.{(((((((((((.....)))))))))))},,....,,,,,,,...,{.{{||||.,,)}))))),.)))))))))...,,,....|{,{{||,,,.,.,,,,,,))))))...)))))).,||}}}))))))..})))).}},......}}}}|||||{{(,,((((.(((((.(((((.((((.((((....(((.........,{{((((({.(((,({{{{{{,|||||,,,},,,...,))))},,}}}}}}}(((((((,,,({...,|||||,,{,{(({{...((((((...(((....)))...))))))...))))),,,,,.,..((((((((((((.....))))))..)))))))))))))......{,{.,,.{{(.,......}}}.}})))...))).}).})))))|((((((((.....))))))))))))))).))))))).)).))))),)))}),)))))))))...))))))))))))......((((((((((((((....))))))))(((((((....)))))))(((((((..(((({({,,,,,,,..(((((((((((......((((.(((.....(((((....)))))....})).,))).((((((((((..({{{{{..,.}}})}.,......{(.{(((((((.(((((((((((((.((.((({.....,...,)))..)).)))))))))))},).)))))))}.)}.},,)))))))))).))))).)))))).{(((((((({.,,....,{...,|,..}},........{{{....)))))))))))}...,},,,...}}))...))))))).))))))..((((((.,..{{.((.((({..((((..,.....,,(.......}})........)))))))))))))))))).......((((((.((((((((((((..((((((.(((.((((({..,....,..}))))).))}.))))))...))))))))))))..)))))).))).

Transcripts

ID Sequence Length GC content
GUGGACGCAGCGGGCUUUGGAAAGGCCCCAAGUUAAUGAGGCGUGCGCC… 5913 nt 0.4296
Summary

This gene encodes an evolutionarily conserved proline-histidine rich nuclear protein. The encoded protein may play an important role in the anti-apoptotic effects of insulin-like growth factor-1. [provided by RefSeq, Jul 2008]

Forensic Context

A study in human left ventricular tissue and a rat ischemic cardiomyopathy model identified the PHLDA1 as a novel molecular marker, with its expression significantly elevated in patient samples, animal models, and hypoxic cardiac muscle cells [Wang et al. DOI:10.1007/s12031-018-1066-6]. A study in rats using an organotypic hippocampal slice culture model of traumatic brain injury demonstrated that the PHLDA1 was downregulated at 24 hours following a mild (10% Lagrangian stretch) injury, as identified through microarray analysis, where it was categorized among genes associated with apoptotic processes [Di Pietro et al. DOI:10.1089/neu.2009.1095].