| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGAGCCGGCGCCGUCACCGCCCGCAUUGCCGCUCCCAGUCCCGCGCUCG… | 920 nt | 0.6283 |
This gene is located in a cluster of imprinted genes on chromosome 11p15.5, which is considered to be an important tumor suppressor gene region. Alterations in this region may be associated with the Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, adrenocortical carcinoma, and lung, ovarian, and breast cancer. This gene has been shown to be imprinted, with preferential expression from the maternal allele in placenta and liver. [provided by RefSeq, Oct 2010]
A study in humans demonstrated that the PHLDA2 gene, involved in regulating glycogen metabolism, cell migration, and apoptosis, was upregulated in the subcutaneous adipose tissue of heavier co-twins within BMI-discordant monozygotic twin pairs [Muniandy et al. DOI:10.1038/ijo.2017.95].