Basic Information

Symbol
PHLDA2
RNA class
mRNA
Alias
Pleckstrin Homology Like Domain Family A Member 2 BWR1C HLDA2 IPL TSSC3 Tumor-Suppressing Subchromosomal Transferable Fragment Candidate Gene 3 Protein Beckwith-Wiedemann Syndrome Chromosomal Region 1 Candidate Gene C Protein Pleckstrin Homology-Like Domain Family A Member 2 Tumor Suppressing Subtransferable Candidate 3 Imprinted In Placenta And Liver Protein P17-Beckwith-Wiedemann Region 1 C P17-BWR1C Tumor Suppressing Subchromosomal Transferable Fragment CDNA 3 Pleckstrin Homology-Like Domain, Family A, Member 2 Tumor-Suppressing STF CDNA 3 Protein P17-Beckwith-Wiedemann Region 1C Tumor-Supressing STF CDNA 3 BRW1C
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_003311.4
Sequence length
920.0 nt
GC content
0.6283

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
- kcal/mol
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
-

Transcripts

ID Sequence Length GC content
AGAGCCGGCGCCGUCACCGCCCGCAUUGCCGCUCCCAGUCCCGCGCUCG… 920 nt 0.6283
Summary

This gene is located in a cluster of imprinted genes on chromosome 11p15.5, which is considered to be an important tumor suppressor gene region. Alterations in this region may be associated with the Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, adrenocortical carcinoma, and lung, ovarian, and breast cancer. This gene has been shown to be imprinted, with preferential expression from the maternal allele in placenta and liver. [provided by RefSeq, Oct 2010]

Forensic Context

A study in humans demonstrated that the PHLDA2 gene, involved in regulating glycogen metabolism, cell migration, and apoptosis, was upregulated in the subcutaneous adipose tissue of heavier co-twins within BMI-discordant monozygotic twin pairs [Muniandy et al. DOI:10.1038/ijo.2017.95].