Basic Information

Symbol
PIK3CA
RNA class
mRNA
Alias
Phosphatidylinositol-4,5-Bisphosphate 3-Kinase Catalytic Subunit Alpha PI3K Phosphatidylinositol 4,5-Bisphosphate 3-Kinase Catalytic Subunit Alpha Isoform Phosphoinositide-3-Kinase, Catalytic, Alpha Polypeptide Serine/Threonine Protein Kinase PIK3CA PtdIns-3-Kinase Subunit P110-Alpha Phosphoinositide 3-Kinase Alpha PI3K-Alpha Phosphatidylinositol-4,5-Bisphosphate 3-Kinase 110 KDa Catalytic Subunit Alpha Phosphatidylinositol 4,5-Bisphosphate 3-Kinase 110 KDa Catalytic Subunit Alpha Mutant Phosphatidylinositol-4,5-Bisphosphate 3-Kinase Catalytic Subunit Alpha Phosphatidylinositol-4,5-Bisphosphate 3-Kinase, Catalytic Subunit Alpha Phosphatidylinositol 3-Kinase, Catalytic, Alpha Polypeptide Phosphatidylinositol 3-Kinase, Catalytic, 110-KD, Alpha Phosphoinositide-3-Kinase Catalytic Alpha Polypeptide PI3-Kinase P110 Subunit Alpha PtdIns-3-Kinase Subunit Alpha PI3-Kinase Subunit Alpha EC 2.7.1.137 EC 2.7.1.153 EC 2.7.11.1 P110-Alpha PI3Kalpha P110alpha EC 2.7.1 CLAPO CLOVE MCMTC CCM4 CWS5 MCAP HMH MCM
Location (GRCh38)
3:179148114-179240093
UCSC Genome Browser Search in Marker Scope
Forensic tag(s)
Wound age identification Mechanical injury analysis
External database
HGNC NCBI Ensembl OMIM UniProt GTEx

MANE select

Transcript ID
NM_006218.4
Sequence length
9259.0 nt
GC content
0.3569

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-2273.00 kcal/mol
Thermodynamic ensemble
Free energy: -2458.45 kcal/mol
Frequency: 0.0000
Diversity: 2899.26
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((((((((.((((.((.(((((.((...((((((((.((((((((.(((.(((.(((.((.(((((.(((((.(((((.....))).)).))))).))))))).))).))).)))))))))))((((((((((.((((.((((.(...).)))).))))..)))))))))))))))))))).))))).))..)))).))))))))....((((((((.((..((.((((((((((((((((.((((......)))).)))...........((((((((.((((.(((((..((((((((...(((((.....(((((....(((((.(((((..((((....))))...))))))))))....)))))..(((((((..............((((((((((.((((.(((((((((..((((.....(((((...)))))...........(((((((((((((((.((((.(((..(((((((((.(((((((((((((...((((((((......((((((((((((....)))))).....)))))).((((((((..(((....((((....(((((.....))))).....))))....)))..))))))))....((((((.(((((..(((.(((..((((((............((((((..((((((((((((........(((..((((((((((((((((((..((((((((..(((((((.(((((.(((......))).))).))))))......))).)))))))).(((.((((((((((.(.((((((.(.(((((((...((((..(.((.(((((((((((((.(((....(((((.............................)))))......((((.((((((((((((......((((.....(((((.(((((((((...((((..(((..(((((.(((((..(((((........(((((....)))))(((.(((...(((.(((((((((((((.....((((....(((((((.....)))))))....))))))))).))))))))...)))....(((.(((.....))).)))........((((((((.(...(((((...((((((......)))))))))))).)))))))).(((...(((.((...(((((((((((((((....((((((..(((((((((((.((........(((((.(((((((...((((((..((((......((((......))))(((....)))....(((((....)))))........(((((..(((((....)))))..)))))...(((......)))....((((((.(((.(((...))).)))))))))(((((....))).))((((.....)))).))))..))))))...((((...))))((((.(........).)))))))))))))))).((((((((...)))).))))......((((((..((.((((...((.((((((.((.......))..)))))).))..))))))....)))))).)).)))))))))))))))))..........((((((......)))))).(((((...))))).....)))))....))))))))))..)).)))))).........))).)))(((((....)).)))..(((((...))))).......((((((((.(((...)))))))))))..)))))...))))))))))...)))..))))..(((((((((((..((((((.(((....))).))).((((..((..(((..((((((((.((....((........))....)).))))))))..)..))..))..)))).........((((..(((...)))...))))....((((...)))))))..))))))))).))((.(..(((.((((...(((.......((((....)))).....)))..)))).))).)))....))))))))).)))))..))))..(((((((.....((((((....(((.......(((....((((((...))))))..)))...))))))))).....))))))).....)))))))))))))))))))..)))))))))).))).)).)..))))...)))))...((((.((((..(((((((((((...((((..((.((((...((((..((((((.....))))))))))....)))).))..))))..))))).))))))..((((....))))..((((.((((((((((...(((((((((........)))))).)))..........((((.(((((((..((((((((....((((((((((...))).)))))))......))))).(((....)))..(((.(((..(((((......)))))..))).)))....(((((......)))))....(((((........(((.(((((..(((((((..((.(((((.(((((((.....).))))))...))))).))))))))))))))..)))...........)))))....)))))))))).)))).)))))))))).)))).)))).)))).......)))))))))).))))))))).)..)))....)))))))))))(((.(((...))))))....((((((((((((....))))))))))))..((((.....))))..............)))))))..)))........))))))))))))..))))))))))))...))).)))..))))).(((((((((((((..((((.(((((.(((((((...((((((.........((((((((.(.((((((.(((((((((((.((....)).))).((.((((((...((((((...........))))))......(((((...((((((..(((((..((.(((((((.(((.((....)).))).))).)))).))..)))))..)).))))..))))).)))))).))((((((....((.((......)).))...))))))(..(((((((.....))))...)))..).(((((((.....)))))))........((((.....(((....)))..))))....))))).))).))))))).)))))))).........((((((.(((....((...(((.((((......((((((((...((..(((((((....((((.....))))....)))).))).))))))))))......)))).)))...))...)))))))))(((((.(((((......(((((((.(...((.(((((..((((.((((.((((.((.((((......)))))).)).)))))).))))..(((((.......))))).....(((......)))((((...........((((........))))..........))))))))).))...).)))))))...((((..........)))).))))))))))....)))))).))))))).)))))))))......)))))))).)))))))))))......((((((..((((((...((((.(((.......(((((.....((((.....(((((....(((((((.(.....).)))).)))....))))).))))..)))))........))).)))).)))))).....))))))...((((((.........))))))...))))))))((((((...............))))))................................))))))))..))..........)))))))))))))))..)))))))).)))))).....))))).......))))))))))))).)))).)))...)))))))((((((((((((..(((((((((((.((((((((...(((...)))...))))))))..(((((.......)))))....((((((((((.(((((((((.((((.(((((((((..(((..(((((((.............))))))).)))..)))))))))))))......(((((((..........)))))))...((((..........)))).....((((((((.((((.(((((((((.((((((((((((((.(((..........((((((...))))))....((((((.....))))))...)))..))).)))))))))))........(((((((((((.(((.((((((.....)))))).((((........)))).......))).))))))))))).((((((...(((....(((.((((.........)))).))))))....))))))..((((((((..((((((((....)))))))).((((((..((.(((((((..((.....))..))))))).))))))))....(((((.((((...)))))))))(((.(((((...(((((.(((((.((((((((((((......((((((........))))))((((((((((((....)).))....))))))))........(((((.........(((((((..((((((...........................))))))...............(((((((..........))))))).....((((...(((..(((((....(((((.....))))).)))))..))).))))))))))).......))))).......)).))))))))))....))))).))))).....))))).)))...................((((((.............))))))))))))))))))))))).)))).))))))))..)))))))))))))))))))((((((((((.......((((((((((.((((((((...(((...((((((((.............)))))))))))(((((....)))))(((((((.....((.(((((........))))).))...)))))))...))))))....(((((....((((((((.((((((((((..(((((((((.((((((....)))).)).)))))).)))..)))))....)))))..............(((((((...((((.(((....)))..))))..))))))).......((((....))))))))))))....)))))...))))))))))))((((((((((((......((((((........((((((.....))))))((((...))))......))))))...(((((........)))))(((.((((...))))))).(((((((.(((((((..((((((((..(((((.....((((((.(((((((....)))))))..)))))).......((((((...))))))......((.((((((..(....(((((((((((((.((((((((.........(((((((..((((((((.....))))))))..)))))))...((((((((((((((.............((((...........(((((.((((....((....((((((...(((((........)))))..))))))..))....)))).)))))))))(((((((.....(((((((((..((((((((((((((.......(((((..((((((((((..(((((....(((((((.......((((......)))).......((((((((((((.((((....(((.......(((((((..........................((((((((((.(((((................(((((((((((((.(((((((((((((.((((.........(((.((((......................)))).))))))).))...)))))))....))))((((..........))))..((((.(((((...((((((((.....)))).))))...)).))).))))..(((((((((..............((((((((((.((.(((....((((((............)))))).(((((.........)))))...((((((((.(((.....))).))))))))....((((((((.((((..(.............)..))))..))))))))....))).))..)))))))))))))))))))(((((.......))))).(((((((..(((....))).....)))))))..........)))))))))))))((((((((((((((....))).......))))))))))))))))..))))))))))...(((((((.(((.(((((((((......))..))))).)).))))))))))...(((.(((((((.....))))))).)))((((((((((....(((((......)))))....)))))...)))))..)))))))......)))..))))....)))))))))).))........)))))))...)))))...........)))))))).......))..)))))))))))))))).((((((((.....((((((((..........))))))))))))))))....((..(((((......)))))..))..(((((.((((((.((((((....(((((((((....(((((..((((......))))..)))))...))))............)))))....)))))).)))))).))))).)))...))))))))).......(((((((((..((........))..))))))))).....(((.....))).....(((....)))((((((((((((..((((((((.(((..(((((........))).))((((..((..(((((((.(((((....(((((.((((((((..(((((((.....))))))).((((((((((((.(((.((((....(((.((((.......((((((((((((...)))))))...)))))......((((((((((...((.(((((.....((..((.((.((((........)))))).))..))))))).))..))))))))))..)))))))...))))(((((.((((....(((((((((((((((.(((((.....)))))((((((((((((((((((.....))))).((((((....))))))(((((((((((.(.(((((...)))))).)).......))))).))))....)))))))..)))))).((((((........))))))...)))))).)))))........(((((.(....))))))...(((((...)))))..................(((.(((((((((......))))))))).))).......(((((...)))))))))....)))).)))))((((((((((((((....))))....))))))))))..)))))))))))))))..........(((((..........)))))((((....))))..))))))))...)))))....)))))..(((((....)))))...........)))))))..))))))......)))..))))))))......))))))))))))((((((..((((((....((((..((((....((...((((((.....))))))..))...))))...))))))))))))))))..((((((.(((...))))))))).)))))))(((((((.....((((((((((((..(((.((((.((.((((((((((((((((..(((........)))..))))))))))..((((((.......)).))))..((((((((....))))))))........)))))))).)))))))..)))))))...))))).......)))))))....))))))))))))))...........((((((((((((....(((((..(((.((((((.............)))))).)))........((((.((((..((((..(........)..))))....))))))))..)))))..))))).....)))))))..((((...(((((..(((((((....((((((....((((..((.((..(((.((((((((...(((..(((.......)))...)))....)))))))).).))..)).)).))))........))))))....)))))))..)))))...))))...................)))).))))))))).))))))))...)..)))))).))(((((((.....)))))))(((((..........))))).....((((.((((..(((((((((((((....)))))))))))))...)))).)))).......(((((((((.(((..................))).))))))))))))))..)))).............))))..)))))))..))))))).................)))))))))))).......((((......)))).))))))))))((((....((((((.(((.(((((((...)))))))..))).)))))).....)))))))))))))))......(((..((.....))..)))......((((((((........)))))))))))))).))))))....)))))))....(((.....)))..................((((((((((...((((.....................(((((......(((..((...((((..(((((..(((......))).)))))....))))....))..)))..))))).....((..((((((((((....(((((...))))).))))))))))..))))))..))))))))))...))))).))))))))..))))).)))))))).))))............................))))).))))((((((((....)))))))).)))).)))).))))))))...((.((((.((.....)).)))).)).....(((..((((.(((((....(((((.((......)).)))))...))))).))))..))).......
Thermodynamic Ensemble Prediction
.((((((((.((((.((.(((((.((.,.(((((({{.{{((((((.(((.{((.(((.((.(((((.(((((.(((((.....))).)).))))).))))))).))).))}.)))))))))||((((((((((.((((.((((,(...}.)))).)))),.)))))))))))))))))),).))})),)),,)))).)))))))).,,.{(((((((.((|,(({(((||{(((((((((({(((({....})))),))).....,,....(((.((({,((,..((((({{((,,,,||}}}|||||.,,}}}|,|}}...,||{,,{,,,,.,({{{...,||}|..,({.((((((((.....))))))))}}.,....,{((((({...}}}}))){,....|||,{((((({,,{{,{,,...(((((...)))))..............,..{({((((((......{{((((.,,{,..............,,..}}}}}}.,{{{,|...,,,{{{((......}}))){{{{,,..,||,,((.(((((((..(((((((((((((({{(({(.....}}}||,..,,||,(((,,({{{{..{{{{...})))...}}}}}..}||,(((((,,(((((({.......(((....)})..{(((((..((((...}))).))))}}{.((((((((((...((((.((((((((.,,(((((({{((((.(((......))).))).)))))),.....})).))))))))...)))))))))))))|.{,,,((,{{|{,.....|}|||||.,,......},}}}.}}}}}||,....|||||..............,,,,,,,|,..,{{{||,||......{{((,((((((((((((,,,,,.((((.....(((((.(((((((({...{{{{..,,|,.,(({({{((((({(,,,({{(((({.,(({({{{.,,,,)}||.|,....,{{.((((((((((((,,,{{{((((....(((((((.....)))))))....)))))}|,,.|||||||,...)))}},.|||,|||,,..,))),))}........{(((((((.({.,({(((,,{(,{,,.....,})})))},))))).)))))))),{({,,.,{,.|}}|.,((((,,,,,,||||.||,{(((({..(((((((((((.((........(((((.(((((((,..((((((..((((......((((......)))){{,....}}}....{{{((....)))}}.......,(((((..(((((....)))))..))))).,,||{|,,..,}}}....((((({{(((.(((...))).))))))))}.{(({.,,,,||.,,{{||,,,..)))}.))))..))))))...((((...)))){(((.(........}.)))))))))))))))).{,{(((,(,...,,..,,)).,,,,.{(((((..((.((((...{{.((((((.,{.......,)..)))))).}}..))))))....)))))).}}.)))))))))))}))))).......}}}}||||,..}}}}))),},.(((((...|}}|}....,||||,....||}}})))))..,,.}}}})).||,},.,,,,{{{{{((((,....}},,|,..(((({...))))).......((((((((.(({...)))))))))))..,})))))))))}|}|||}...,}}.}))})}.{((((((((((..((((((.(((....))).))}.((((..((..(((..((((((((.((,....{.,,..||.}}..,,)}.))))))))..)..))..))..)))).........{(({..(((...)))...}))}....((({...}))))))..))))))))).}}{{,{..{((.((((...(({,......((((....)))).....)))..)))).))).,}}....))))))))).)))))..)))}..{({{{{|,|...{((({({{{,,{{.{|{|||{{{....((((((...))))))..|||,|,,}})))}}}...,.}}))))}}},..,}))))))))))))))|||{{{,|||{{{{(((((((((((((.(((..((((({.((({(((((({.(((((((((((...{{((,,((.((((...((((..((((((.....))))))))))....)))).)),,)}},..)))))}})))))...,{,((,{{(,,,,|}}}||,|,{,.,,,,,,(((((((((........)))))).}}}..,,,.||,..|((({{{{{..,}},,)))))))),}}},..))))))).}.))).}))))).))).))))))).)))))}}}}(((.(((..(((((......}))))..))).)))(((((((((({..{{{(({{{,{(({{(,..{{{{{((((...((((((((((((((((((((((...((((.(({,(((.......,,.((((....)))).,)))))).)))).......)))))}.,.,|||||,,,}|}|,((((({.((((.(.(,.....,).))))).}}...,)))},|||||||}||,,{(((,,..|||,(({{...}))),|,{{{,((({,.||||||,..,((((((((((((....))))))))))))..((((.....))))..,{{{{{{{{{{,{{{,,....||}}..,,.,,|||||,,|||||,{|||||||,{,,||,,{||{||},,||||||||{{{(,,{{,,(,(((((((({,(({{((((.(((((((,{{.....|}.||}||||.{({(..,{{{({((|.,,{{{,|||||,,,.})),{{.{{((((...((((((...........))))))......{,{({...((((((..(((((..((.(((((((.(((.((....)).))).))).)))).))..)))))..)).))))..})))},}}}})),}},,.||,.}}||}}}..}}.}}}}||,}..}},}))|}}}|}}}||,{|,,,||||{{{{||,|.(((((((.....)))))))..,..,,|{{{{,,..,||({{{.|,|{||,||.,,,}}})).))))}).})))||{{{{|||..|{{,...{((({({(((....((,,.{((.((((,,...{((((((((...((..(((((((....((((.....))))....)))},))).)))))))))}}}....)))),)}),..)),},))))))))|(((((.(((((......(((((((.{...((.(((((..((((.((((.((((.(,{((((......)))))).)).)))))).))))..{((((.......))))},,||.{,{,,,,,.}}}((((...........((((........))))..........))))))))).))...}.)))))))...((((..........)))).)))))))))),.}}}}))))})))},}}.,,},|||||,||{{|||||||||{{,,|{,..}}}....,},.{((((((((,{,,.,{{{{,{{(,,..,,,{..,,.......,.,....,,,...,,,{{{{{{{.{..,,.,,|||{({,,{{.{||,,,,,.{{{((({(({{{,,...||,,{{{{,||||||{{{{{((((.(({.((((((.........)))))))))..))))}}}}}|{{||.,.,{{||...,,,,,..,.,,,,............,,....,,{{{{{{,|,.,|{({({(((((({,......}))))))).)))}.},..,,)))))}))))))))}})}))))......,}}}))))},}}})||},||||}||||,{{|,,..|||,||{{....,,)))),}},{(((((((,{.((,...})).,.)))))))).})))))))},,,,||||}}}}}}}}||||}}}|{{{{(({{({{,,({(((((((((..,(({{(((({(({{..({{{,{,..,,))),,}))).,)))}|||||{{{{{{{{(((({...|}))}}{{{{{|{(({..,,,{((((({{{{(({{{{{{{{......,.}}|||}},....,(((((.((((((((((((((.(((..........,((((,...,}))))....((((((,...,)))))).,.)))..})).}}))))))))),..))))}.,,,,{(((((.{{{.,,,,,,}}}}}),})))}}}}}}},...}.},,,}}}}}}}))).}}}}}}}|}}|.,||{{{,{..||||,{{{{.,|||,,)})},)}}}}}|}},}}}}},,||}}}|.,.,,,,.|}}}}}||))|}......,,,,,,.{(((((.,({.(((((((..((.....))..))))))).},))))))....(((((.((({...))))))))),,...,,,}})}}}}}}},},}})},}}})})},}))))},.|||||(|||,|.|||,,,,},,,}))||}}|},..})).,,.,}})},}||||||,.....,|}|}}},,,,,.....,||,,}}}.}}))))))))))))...,.))))),..,||...}}}),.,,...,})))},,.})})))}......}))))))))))..{{(((...(((..(((((....{{{{{.....,}}}}.)))))..))).))))).,,....(((({.{,.((((((((...........))))))))...}}.)))))...,}}}})},)}}}}}.,,,.}}}}},....,}}}}},,,{{{{{{({{({,((,,.{{{{{,,{{{|||,..|||,,}},,,.....{{{((({{{,...||,...(((((((((((.......{(((((((((.{{((((((...{{{...((((((((.............))))))))}}}(((({....)}})}(((((((.....((.(((((........))))).))...)))))))...))))))......(((({{.((((((((.((((((((((..(((((((((.((((((....)))).)).)))))).)))..)))))....)))))........,,,,..(((((((...{(((.(((....)))..)))}..))))))}.......,{{,..,.)))})))))))}...,.))))}}.)))))))))))|((((((((((((,,{{{,{{{{{,,{{{{,,.((((({.....}))))}..,},,,)))).,....}))))),..(((((........))))}(((,{{,....))},))).(((((((.(((((((..((((({{(,,((({,.,,,.((((((.(((((((....)))))))..)))))}.......{{((({,..|}}}}}......((.((((((..,....((((((((((({{(((((((((.......,.{((((((..{{((((((.....))))))}|,.}}}}}}|...(((((((((((((({((({.......((((((({......{,,,.,{|{{{{....,,,,.,((((((...(((((........)))))..)))))}...(((((((.(((..{{...((((((((...{{(.{{(.((((((((((({((,,,,..........,{,|{{{(((({({({(((,{,..,|||||{{{.......((((......|||}......,{,{(({{{{{{{.,,{,.,,.,{{|{.....(((((({,,,.,.,,,.........,|{,....((((((((((.{((((,{{,,,,,.,,{,,{((((((((((((({.(({((((((((((,({(({,,,,,,,.,{{{((((,,,.,,{{,.{,|||..,|,,,}}||,},}||||.}}...|}|}||}.,,,||||{{{,......,{,({{|...||{{|{{.,,,|||||{(({{,,,,.}}}}|||||{{{||.|||,|||,..(((((((((..............((((((((({..,.{{{....((((((............)))))).((((({,....||.}}}))...{(((((({.(((.....))).}))))))}....(((({{{{.,{{{,.,,,|,,,..,..,}|,.}))},.}}}}))})....)}).})},))))))))))))))))))){{{{,.......}}}}}.{{|||||}||||,,,.},,...,,))}})))}.,,,},,..,})))))))))))}|{{{{,,||,|||,.,,|||,|,.|,,}}|}}|||||.}}}}},,}))))))))).,.{((((({,(((.(((((((((......)),.))))).)).)))))))))}...{((.(((((((.....))))))).))}{(((((((((.,..(((((......)))))..,.)))))...)))))..))))))},,,,,,,||,,,|||...,})}))))}))})},.....,,||}}}}),,,,}})}}}|}}|,,...}})))))}.,|,|||{,,||||}}}}}}}|||||..(({{({{{,...,{{(((({{.......}..))))))))}))},,,}.,}}|{..,|||,.,,,,.))))),,)}..|||{{.{{{{((,((((((,...{((((((((.,{{(((({,,({{{,,,{,,,|||,,}},,)},,)}}},,,,,.......}}}}},...||||}}.}}}})),)}))),}}}..,||||||||,.......(((((((((..{{........))..))))))))).,...{{{....,))}.....|((,,..|||(((({(((((({.{((({,,,||}|}{{(({{{........))}.||{{|{,.,{{{{|||{,..,,,{,...{((((({{((((((,..(((((((.....))))))).{(((,((((({(.,,,.,,,,.,.}|||}|||{..,....,,,,,(((((((...)))))))..,||||||||,,,,,,,,{{{,,.,{((.((((({..{{((,.(({(,.,,,|}}}.,}}}),,))),}),.,)))))}|})|}))))))})))}})))))))}}.})))|||||.{|||,{,.(((((.(((..((...(((((.....)))))..||..))).))))),||.....}}}||,({((((.,,,}}})))|....||||||}|,(((({...}))}}...{((((......))))}|{,,,.||||||{{{(((.({.((((((........)))))).}).)))},})))},........||||,}}}}},,)))),,,}))))|),)))))),}}}},............(((.(((((((((......))))))))).)))....,,}|}}}}}},}},},}}))}...)))).}))))||||{{{{{{,{{,....,}}}....}}}))))}}},,)))})))))))})}}.....,|||,||||{,,......,,))}}}(({{....}))).,}))))))}},.)))),.......,..{((((({..{|||||.....{{..((.(({...))).)).)}....})})}},},)))))}}...,)))))))))))}((((({.{((({((,,..{(((..((((....((...((((((.....))))))..))...)))),,.}))))}))))))))))...||,|})))))))))}}).))).)))))))).}}..))}...)))))))..,||,,......,,.(((...(((((((((((((..(((........)))..)))))))))).)))))))))))))).}}.}})))((((((((....))))))))...,,....,,.((((((((((((((....)))))))))))))....{{,...}}),..))))))))))))))...........((((((((((((....(((((..(((.((((((.............)))))).)))........{(({{{|,...|||(,{({{,,,...,.,||,,.},,,))))))),.)))))..))))),....}))))))...,{{...(((((..(((((((....((((((....((({..,{{(({{(({.{{{{{{{{...{{{..(((.......)}}...}))....}}}))))),},))..},,)).)))),}}}.}}}))))))....)))))))..}||||...{{|,,,,,},,...,)))..,,.)))).))))))))).))))))))...,..)))))).}){{{((({.....))})))){{{{{....,,,...)}}}|.....((((.((((..(((((((((((((....)))))))))))))...)))).)))).....,.{((((((((.{{{..,,,,,........,,,))).))))))))),}}})..}}}}.............))))..)))))))..))))))).............,,,.)))))))))))),.....,({{,.,,,..}}}}.))))))))))),}}})),((((((.(((.(((((({...}))))))..))).))))))..,}}}}}}}.|||||.(({{{,{(({((,.,,....,)))))}}}}....((((((((........))))))))..........,,..},,.})))))),})),)}}}},}},...,}})|}}}}.....,)}||}|}}}}},,,}}},,,.}))))))))))))))......))))))},)}..,......,||}|}|||,,|{{{..||||||,|||,|||{{{{|,}..,})}}||,,||||||,....((..((((((((((....(((({...})))).))))))))))..))}}}}...}},,,|||{{{{|||,,.))),))))}})||||,|},}})))})))}..,,,,,|{||.,,,|,........,..,,}}},||||((((((((....)))))))).}}))}),}},}})}}))},,,}|.|}}}}}}}}...}}}.,)),))},...||{,,||||}|{{,,,,,,||{|{,|{,,,,..)).))}))...,},,,.,,,,..}},.......

Transcripts

ID Sequence Length GC content
NM_006218.4 NCBI
AGUUCCGGUGCCGCCGCUGCGGCCGCUGAGGUGUCGGGCUGCUGCUGCC… 9259 nt 0.3569
Summary

Phosphatidylinositol 3-kinase is composed of an 85 kDa regulatory subunit and a 110 kDa catalytic subunit. The protein encoded by this gene represents the catalytic subunit, which uses ATP to phosphorylate PtdIns, PtdIns4P and PtdIns(4,5)P2. This gene has been found to be oncogenic and has been implicated in cervical cancers. A pseudogene of this gene has been defined on chromosome 22. [provided by RefSeq, Apr 2016] CIViC Summary for PIK3CA Gene PIK3CA is the most recurrently mutated gene in breast cancer, and has been found to important in a number of cancer types. An integral part of the PI3K pathway, PIK3CA has long been described as an oncogene, with two main hotspots for activating mutations, the 542/545 region of the helical domain, and the 1047 region of the kinase domain. PIK3CA, and its interaction with the AKT and mTOR pathways, is the subject of an immense amount of research and development, and PI3K inhibition has seen some limited success in recent clinical trials. While monotherapies seem to be limited in their potential, there is a recent interest in pursuing PI3K inhibition as part of a combination therapy regiment with inhibition partners including TKI's, MEK inhibitors, PARP inhibitors, and in breast cancer, aromatase inhibitors.

Forensic Context

A study in humans demonstrated that the PIK3CA is a key regulatory component in disease networks, where it was identified as a central node in the network of miR-375 target genes associated with cardiovascular disease and is regulated by miR-375 [Baulina et al. DOI:10.1016/j.yjmcc.2018.07.129]. In a separate human study on burn wound healing, the PIK3CA was identified as a direct target of miR-155 and miR-506-3p via dual-luciferase assay, with its protein expression being inhibited by these miRNA mimics, and its targeting within the PI3K-Akt pathway contributed to the inhibition of fibroblast proliferation [Li et al. DOI:10.1002/jcla.24564].