Basic Information

Symbol
PIK3R2
RNA class
mRNA
Alias
Phosphoinositide-3-Kinase Regulatory Subunit 2 P85-BETA P85beta P85B P85 Phosphatidylinositol 3-Kinase 85 KDa Regulatory Subunit Beta Phosphoinositide-3-Kinase, Regulatory Subunit 2 (Beta) Phosphatidylinositol 3-Kinase Regulatory Subunit Beta Phosphoinositide-3-Kinase Regulatory Subunit Beta PtdIns-3-Kinase Regulatory Subunit P85-Beta PI3K Regulatory Subunit Beta PI3-Kinase Subunit P85-Beta Phosphatidylinositol 3-Kinase, Regulatory Subunit, Polypeptide 2 (P85 Beta) PtdIns-3-Kinase Regulatory Subunit Beta PI3-Kinase Regulatory Subunit Beta MPPH1 MPPH
Location (GRCh38)
Forensic tag(s)
Wound age identification Other applications

MANE select

Transcript ID
NM_005027.4
Sequence length
3980.0 nt
GC content
0.6407

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1760.07 kcal/mol
Thermodynamic ensemble
Free energy: -1824.04 kcal/mol
Frequency: 0.0000
Diversity: 1223.06
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..((((..((((((((((((((((.(((..(((((((....(((((.((((.(((((((((.((((((..(((.((((((((((..(((.((((((((((((((.(((((((((((((..(((((((....(((((((.......)))))))..((.(((((((.(((((((((...(((......))).)))))))...))...)))))))))...((((.(((((((((....(((((((((.(((.(.((.(((............(((((..(((((..((((.((((((.(((((((.(((.....(((((.(((.....((((((.........))))))....)))...).))))....)))..)))))))........((((((((.(((..(((.((((.(((.(((.((.((.(..((((((.(((....)))))))))..))).))..)))))).)).)))))...))).))))))))......)))))).)))).)))))))))).............))).)))))).)).))))))))))))))).).))))...((((.((((((.(((((((((((..(((((((....)))))))((((.....)))).(((((((((.(((.....))))))))).))).((((((((((((..((.((.(((...))).)).)).))))).)))))))))))))))))))))))).))))(((((((..((((.((((.((..((.(((.(....)))).))..)).))))..)))).)))))))))))))).((((((((((((((((.(((.(((((((((...((.........))..)))))))))..((.((.(((..((((((((((...((((..((.((((....)))).))......(((...(((((((((...((((....))))...).))).)))))....)))...((((.((..((.((...)).)).))))))))))(((..(((...)))..)))...((((..((((((.(((((..(((((...(.((((((....((((............))))..)))))))))))).))))).)))))).))))...))))))).)))..))).)).))(((((((((((....))))))))))))))))))))).))))).))))....))))))))))))))))).)).)))))))).)))....)).)).)).)))))))((((((((.(((.(((.((((((((.(((.((((.....))))))).))))........)))).))).))))))))))))))))).))))))))).)))).)))))((((((((((((((...))))))..)))...))))).(((((((((...))))).)))).......((((((....)))))).(((((((((((.((((.....))))(.((((((...(((((((.(((...))).(((.(((..((((((......((((((......))))))...))))))..)).).)))..))))))).((((((..(((((((((((...(((...)))(((((...)))))....)))).))))..)))))))))..(((....)))(((((((..(((....)))..))))..))).)))))).).......(((.(((..(((.....)))..))).)))....((((((....))))))...))))))))))).(((((((((((((..........(((((.(..((((.(((((....((..((((..((((((((((.((........)).)))))))).....(((((((((((((..((((.((((((((((((((((((((((.(((((........)))...(((.(.(((((.((.((...((..(((.(.((((...((......))....)))).).)))..)).)).)).))))).).))).)).)))))).(((((.....)))))((((((....)).))))...((((((((((((((....(((((((.(.(((((((.....((((((.......((.(.(((((.((.(((((((((..(((........))).......((.(((((((..(((.((......)).)))......))))))).)).(((.((.((.(((((.(((((((..((((.(((....(((.(.((.((...(((((.....((((.((((((((((((((.(((.((((((...((((.....((((((((..(((((.((((((((....(.(((.((...((......))..)).))).))))).........))))((((.....)))).....(((.(((..(.((.(((.....)))))).))).)))...)))))..))))).)))....))))...)))).))..)))))))....((((.(((((.((((((((((........))))))(((..(((((((.....))))))).))).))))..(((((((..((((((........))....))))..)))))))...))))))))))))))))).(((..((((((((...)))).))))))).....))))))(((((((...((((((.......)))))))))))))......)))))...)))).).)))((((((...))))))...)))))))..))))))).).)))).))))))).......((((((((....(((((((((((((((((((((..(((((..(((..((((.(.......).)))).)))..)))))..)).....)))))))............))))))))...))))....)))))))).....))))))))).))))))).).))......)))))).....))).)).)).).))))))).....)).))).))))).))))))))))))((((((........)))))).............))))))))((((...))))......)))))))))))....(((...(((..((((((((((.((((((....(((((.......)))))...((((.......)))).((((((((.((((((..((((((........)))))))))).))))).....)))))....)))))).)))..)))))))..)))...)))..)))))).....(((...)))((((.(((...))).))))((((((...))))))...........(((((.............)))))..((((((....)))))).(((((....)))))...(((((((...............................)))))))))..))))..))(((....))).....((((((....)))))))))))))))))))))......)))))))(((.(((((.(((((((..((((.....(.((..((((((...(((...............))).)))).))..)).)))))(((.....((((((....)))))))))(((((((.(((..((((((..(((((((...(((((..(((((((.(((.......))))))))))))))).)))))))....))))))..)))...))))))).........................)))))))))))))))((....))..))))))))))))).))).))))))))).(((((((((..(((.......(((.(((((((...((((...))))...))))..................((((((((.....(((.......)))..))))))))((((((((..........)))).))))))).))).......)))....))))))))).....(((((.(((........)))))))))))))))..))))(((((.....((((.(........).))))))))).
Thermodynamic Ensemble Prediction
..((((..((((((((({((((((((((.{((((({,.,||||{|||||,|||.|{{|||||||||,(,((({..((((.(((((.(((.{({(((((((((,(((((((((((({{(((((((((.(((({{(((((,....,,{{{{|||{,{{.((|((((.||{((((((...(((......))).))))))),|||)|,.))}))))}},..{(((,(((((((((..,,(((((((((.(((.(.((,(((.....,......(((((..(((((..((((.((((((.((({{{{.,{{,..,.{{{{,.{{{...,.((((((.........))))))....})}...,.}}||,,,,,},.,)))))))||......((((((((.(((..(((.(({(,(((.(((.((.((.(..((((((.(((....)))))))))..))).))..)))))).)).)))))...))).)))))))),,....)))))).)))).)))))})))).............})).}}}))),)}.}}))))})))))))},|,||}}...((((.((((((.(((((((((((..{((({{(,,,,|||||||((((.....)))).||||||{||||||}..,.)}}}}}}}}.})).((((((((((((..((.((.(((...))).)).)).))))).)))))))))))))))))))))))).))))((((({,.,(((,,,,(({(({.,({((({..,,,,,,,{||{.|..,|||{{||||{|||||||((((((...((((......))))...)}}})))||||}}}.||,,...,||||||.||||{|},,.,)))||}((({{(,{{(((,,,..{(((({(({(((((..({(({{{(({{{{{.{{{...({(((((((,{,((,,{{{{,|,|.,,|{||{|{||,,....}||.{{(((({((...{.,...{{{{{|.{||,|,(({((,({{(((.{{{,|{.{..((((((((,{{.....}).)))))))),.,}}.}}},.|}{({(((.{.((((.....{{{{....|||,|{{...))).)))..)))),,},.,...|||||,,{|||.,,||{||{||(((((((((((....)))))))))))),||||{{||,{||||{||,..,|.{||,|||||,||,,}||||||,,,.||,|}||.....))}})))).}},|||||{|{{||||,|)}||)}||}}||||.{||,{{|{,,,..})))))}.)))),||......)))}}}}.}}}))})))))))))}).))))},),))))))))),))))))|}}||||||,,.})),))))})}))}}))))).{|||{{(((..{|||||.||}|..{((.,((((((....)))))).{|||(((,(((.((((.....)))),}||,|||...,{|||||.|||,..)))}}}}}|||}}|{|,|,}}}}..||||||}}}}.,}|||||,,||||,,}||}}.}.))).,))))))),|{{{{{..|{|((((((((...(((...)))(((((...)))))....))))}})))..,}}))))))}}|,..}}})).||,,|||.}|||....)))..,,))}})),.,)))))}........{{(,(({..(((,....||}.,|}},||}....((((((....))))))...,))),}}}))),||.|{||||||.,.,,.......||||{|||,,,,|,||||...,,.....||,,.,,((((((((.((........)).)))))))).....{((|||(((((((..((({.((((((((,(((((({((((((,(({((,,,{....|||,..{{{.{.(((((.((.((...((..(((.(.((((...((......))....)))).).)))..)).)).)).))))).,.}},.)),)))))).,,{{||,,||||||,(({{{{....}).))})}}}{(((((((((((((....(((((((.(.(((({((.....((((((.......((.(.(((((.((.(((((((((..,,...{{.{{{{||,...,,,((.(((((((..(((,{({...,,}).))}...}..))))))).}}.(((.((.((.(((((.(((((((..((((.(((....(((.{.((.{(...(((((.....{{{{,{{,{(((({,((((.(((.((((((...((((.....(({(((((..(((((,{{{.{({.....||({(,(({{.,...........},.}}}}))))),........{{,{((((.....)))).,.,.|||,|((,,(.((.{{,.,.,|)))}}}.}}}.}}),..)))))..))))).)))....))))...)))).))..)))))))....((((.(((((..((((((((({....,,,,},,||(((.,(((((({.,,..}}})))).))),}}}}}}||||{{{.|||,{({........}}...})))),})}}))))..,))}})))))}}}}}}||{(((,.((((((({...}))).))))))).}..}))))))((((((({..,(((((.......)))))))))))))......)))))...)))).}.)))((((((...))))))...)))))))..))))))).)}}))).))))))),}),,..{||||.},(((((((((((((((((((((((((..(((((.,(((..((((.(.....}.).)))).))).,)))))..))}....})))))))............}}....)))))}})))))))))}},},,...))))))))),)}))))),).))......))))))...,.))).)),}}.}.))))))).....)),})))))))).)))),,,.,,|,{(((((........)))))).......})))))))))))))((((...))))......)))))))))))...,}},...{(({{((((,,,(((.((((((...,(((((.,,,,.,|}}})...{({(.,.....))}}.{{{{{{((.((({{({,((((((....,.,,)))})})))}.))))).....}}})}....)))))).))))}))))))).})))}}})))}...),))}}...|||.}})))))||}||.,.})))}))))((((((...))))))......,{{{{((((({{,{,....,(((((((((.((((((....)))))).(((((....)))))..,(((((((..,,,..........................))))))),}((((((.{|....,).)))))).........))))))))).}{{{..,,.,))),|...,,,,)))),,|||}|||||}||||||{,}|(((,...,}}}...,,{,,{,....................,,)}))))}})))),})))))))).,,..((((({....,))))),))(((((((.(((..((((((..(((((((...(((((..(((((((.(((.......))))))))))))))).)))))))....))))))..}))..,)))))))...................,}}}{{||||},}}},,}}}}.,...)),..,.))))))}||}}.,})}}))))))))}||,|||,,|}}|||.},..||}...)))}}.}})}{{{{...)))}.{(((((({{{,....,,.......((((((((.....(((.......)))..)))))))).......,,.{(......))))..}))))))))}.......}))},)}),))))))),...,(((((.(((,.......)))))))))))))))..))))(((({,...,{{{{.{........,.}}}}))))).

Transcripts

ID Sequence Length GC content
AGGCCGCUCGGAACCGUGGCGGCGGCGGAGGCGGGGAUCCCGCGGCUGC… 3980 nt 0.6407
Summary

Phosphatidylinositol 3-kinase (PI3K) is a lipid kinase that phosphorylates phosphatidylinositol and similar compounds, creating second messengers important in growth signaling pathways. PI3K functions as a heterodimer of a regulatory and a catalytic subunit. The protein encoded by this gene is a regulatory component of PI3K. Three transcript variants, one protein coding and the other two non-protein coding, have been found for this gene. [provided by RefSeq, Apr 2019] CIViC Summary for PIK3R2 Gene

Forensic Context

A study in porcine skin demonstrated that the PIK3R2 transcript was significantly increased in the 8-minute bromine exposure group at the 24-hour post-exposure sampling time point [Price et al. DOI:10.1016/j.toxlet.2008.08.007]. This gene was identified as part of the acute phase response, EGF, IGF-1, insulin receptor, neuregulin, NRF2-mediated oxidative stress, and PDGF signaling pathways that were significantly modulated following cutaneous bromine injury.