Basic Information

Symbol
PIK3R5
RNA class
mRNA
Alias
Phosphoinositide-3-Kinase Regulatory Subunit 5 P101-PI3K P101 Phosphatidylinositol 4,5-Bisphosphate 3-Kinase Regulatory Subunit Phosphoinositide 3-Kinase Regulatory Subunit 5 PI3-Kinase P101 Subunit PtdIns-3-Kinase P101 Protein FOAP-2 Phosphoinositide-3-Kinase, Regulatory Subunit 5 PtdIns-3-Kinase Regulatory Subunit PI3-Kinase Regulatory Subunit 5 F730038I15Rik FOAP-2
Location (GRCh38)
Forensic tag(s)
Cause of death analysis

MANE select

Transcript ID
NM_001142633.3
Sequence length
4491.0 nt
GC content
0.5743

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1765.80 kcal/mol
Thermodynamic ensemble
Free energy: -1842.51 kcal/mol
Frequency: 0.0000
Diversity: 1113.52
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((((...((((((((((.(..((..((((((((((((((((((((..(((((....).))))..)))).))))))).(((((((((((..(.((.((((((((...(((((((.((.(((...((((((.((((..(((.(.(((((..(((........))).))))).).)))..).))).))))))((((.(((((.((((.((((..........))))..))))))))).))))...((.(((((.(((((((((.(((.((((..((((...(((.....)))...))))..)))).))).))))))))...........).))))).))..)))))....)).)))))...))))))))((((((((((.(((.((((.((((...(((...(((..(((((((((((((((.....(((((((..((((.((((...((((.((((((((((...((((((((.(((((((....(((.(((((((((..(((((((((((((.....(((........))).((((...((((......)))))))))))))).)))))))(((((((((((..((..(((..(((((..(((.......)))..))))))))..)).))))....)))))))......((((((((((((.....((.(.(((.((((((.....((..((((((((............(((....))).........((((.((...))))))))))))))))..)))))).))).).)).))))))))..))))..))))))))))))))))))........(((...))).).)))).)))).((((((((..(((.((((((..(((((((((((((((((.(((((((..(((((((((((((.(((((((((.....((((((((...((((((...((((..((...(((((((...(((..((.((((((((((((((.....(((((...)))))...(((((((.......((((((....(((((((((....)))))...))))...)))))).)))))))))))))...)))).)))).))..)))((((((..((((...(((((((((((((((....(((..(((((.(((((((((((((((.........((((((((((...(((((.(((.(((....))).)))....((((((((((..((((((((((((((((((((((((.(((((((.(((((((...(((..((((((((......)))).)))).)))))))((((((.(((((((..((.......))))))))).))))))..)))))))))).....)))...)))..)))).))).))))))))).))..((((...((((.........))))...))))(((((....)))))..))).)))))))....))))).))))))))))))))).)))))...))))).((.((((((((((((((...(((.((((.((((.....))))...............))))...))).....)))))))))))..)))))...)))))..(((((((((.....((((...))))..((((..((((((...(.((((((..(((((((.((.(((((..(((((((.(((.((...........)).))).)))))))..))))).)))))....))))..)))))).)))))))..))))......)))))))))...........))))))))).)))..))))))...))))..))))))...((.(((((((.......)))))))))...))))))))).))))))))))...))))))))..((.(((..(((.......(((.((..(((......)))..)).))).((((......)))).)))..))).))..........))))))))).)))..))).))).......)))).))))).)).))..))))))))).))))...)).)))))).)))..))))))))..(((((((.(((..((((.((((((((((.(((...)))...)))).((((((...((((......))))..........(((((((.((.((((((((((((((...(((.((....(((.(.(((.((((((...((...(((((((((((......).))))).)))...))...))...))))))))).))))....)).)))......)))))).))).))))).)))))))))))))))..(((((.((..(((((((((.((.(((........))).....(((((.(((((((....((((((......))))))..(((((((.....)))).))).(((((((...(((.....)))(((((.....)))))....(((((...))))))))))))((((((((......((((.((..((((((...(((((((.............((((((......((((....((((((.(((((....((((((...((((.....))))...)))....))).....))))).))))))))))...(((((.........)))))((((((....(((((.(((((((((.....(((((........(((.((((....)))).)))........)).))).....)))))(((......))))))).))))))))))).)))))))))))))...))))))..)).)))).((.((((((.((.(((.(((((...)).))).))))).))).))))).(((((((((((((((((((((((.....(((..(((((((.(((((((((.((((.(((.((((((.((.(((((((...))))))).))((((.....))))((((((((((((((((((((((((((.(((((((..((((((.(((....)))....(((((((((((((((..((((..((((((((((((((((.....(((((((........((((......)))).....((((..((((((....))))))..)))).)))))))..))))..))))))).....)).)))..))))..)))).....)))))))))))....(((((.(((...........))).)))))....((((((.((.(((.(((.(((.(((.............(((((((...(((((.(((((..(((((.(((....)))))))))))))...)))))..)))))))))).))).))).))).))...((((((....))))))((..........)).....)))))).......)))).))..))))))).)))))))....((((......))))))))).)))))))))))..))).))))))(((((.(((((.(((.((...((((((...)))))).)).)))))))).))))).......(((....)))...((((((........))))))((((((....))))))..))))))).))))))).)).......)))).)))..)))))))))).....(((((.(((....)))......)))))....((((((((((.(((((..(((.(((((((.(((((((((.((((.((((...)))))))))))))))))((((((........)))))))))))))..))).)))))..)))))).))))......((((((((..((((.(.(((.((.....))))).)))))..)))))).))....)).))))))).)))))))))))))))..(((((((((((.(...).))))).))))))..))))))))))))...)).))).))))))..)))))))..(((.((((.(((..........))).)))))))(((((..((.(((((((....(((((......)))))..))))))))).)))))..)))))....).))))...)))....)))))))....))))))))))..))))...))))..)))).))).)))).....)))))))...(((((.((.....))))))))))).....)))).)))..))))))))))).))))))).))))))...((((.(((......))).))))...((((.........))))(((.(((.....))).))).)).)..)))))))))))...)))))....(((((((.(((.....)))..)).))))).....(((..((((((..((((((..((((((((........((((((.........).)))))))))))))....)))...)))..)))))).)))...))))..))..).))))))))))..))))))....................(((((.((((((.........)).))))...)))))((((......((((...((((.(((....))).))))...))))......))))...
Thermodynamic Ensemble Prediction
((((((...((((((((((.,((((((((((((((.(((((((((((..(((((....),})))..)))).))))))){((((((((((..((.({{((((((((...(((((((.{(.(((...((((((.((({,.(((.(.(((((..(((........))).))))).).)))..).))).))))))((((.(((((.((((.((({..........}))},.))))))))).))))...((.(((((.{((((((((.(((.((((..((((...(((.....,)),..))))..)))).))).)))))))).....,,....)}))))).))..))))}....)).)))))...)))))))))))).))))))),..}))}{(((((((((,..................,...{((.(((((...((((((((((((({{...(((...)))...}}..))))}}))}((((((....(((.(((((((((..(((((((((((({.,{..(((........)))..||({{.,,{|,,,,{{|,..)))))))))).)))))))(((((((((((..((.,(((..(((((..(((.,.....)))..)))))))).,)).))))....)))))))......((((((((((((.....((.{.(((.((((((,....,(..((((((((............(((....))).{{{,...,|||,.{{...))))),)))))))),)}.)))))).))).}.)).))))))))..))))..))))))))))))))))))...))))).)))))))))))))).)))),.|.(((((((((((..((((((((((((((.((((,(((....))},.)).))...))))))..(((((((.........{((((((((((,,(((...,,,,,}},...))))))))))))).)))).....))))))))..))))))))))),.))).))))))))))).(((.((((((....(((((((((....)))))...))))...))))))..)))..{((((,..}})))|..((((((((.((((((..(.(((((((((((((,(((,(((((.(..((({.((..{.((({...|))),.|.,}}.}}})..},))))).))}.)))}}{(({,{{...,|||{|||{.{,{({{(({.((((((,((((((,..(((({(((({(((((((((((((.((((...(((..(((((((({....,)))).)))).)))))))((((((.(((((({.,((.......))))))))).)))))).((((((((((.(((((((((..(({.{({((..,...))))),|||.,.,({({.,,{{{,........{{||,..,))),,,(((,,.,|||||{{(({({.((({((.{,{{.((((,(.((((((.{((....)))..)))))).}.))))(((((((((((...,((.((,{,({((,.,..,,,}.........,.,}}.))),...)))}....)))))))))))..,|||,.....{|{.{((((((,.(((((((((.{{{((({({((((..((((((...(.((((((..(((((((.((.(((((..(((((((.(((.((...........)).))).)))))))..))))).)))))....))))..)))))).)))))))..))))......||.||}|||}{{{.{,{{{.............}}}}},}}}..,,....||,,..,..{({{{({|,|,,|.|,|{{{.,(({.,,.{|.,|((({,{{{{{{........)),}}))).,)}},,...,}},),,.},}}|.,,}})))}})))))),.))).,))))))).)}}......|||}.(({({,{,....,}.,.))))),........(((({((,{({..{{{{(((({{,,.,,..}}}}))}),.)),,))}..,))},,}})},)))}}|,})),)}}}|,}},},.))))}..))}))))},,}}}.||||..,.....},}),,))),.))))))))).)))))..))))}...,.((((({{{((.(((((((({(((((...(((.((....(((.(.(((.((((((...((...(((((((((((......).))))).))).,,)).,,))...))))))))).))))....)).))},.....)))),).))),,)))).))))))))).}},....)))))))..)))))))|}}|}}}|{,........,}......{(((((((((((((..,((((({......)))))),(((....(((((..(((((((((((((,....(((.....)))(((((.....)))))..,.(((((...))))).((((({{({(..({(({.,,({.......,))))}....))),,..)))))..,||.....||,......}}.((({.((.....)).))))....}))}..})))))))))).....)))))...))))))))))))))))).}}}}}}...}||||}.}}}...{|||||||||,|||,|||||{.,|,{||||,|,.{{({((({{..||{.{{{.,|,|}...,|||{|}|{.{{..{{{|{.,||||,},...{|||(((....))))},..((((.(((((.((..(((((.{..((((((..{(,((((((((,..{((,.((((..,.,,|||}..||}(((({.(((((((((((,,{,(((((((((((((({{(((((((.....(((..(((((((,{{(((((((.((((.(((.({{(((,((.(((((((...))))))).)){|||...,.||}|(({((((((((((({(((((((((((.(((((((..{{((({.(((....))}....((((((((((({(((,.((((..((((((..(,,(((((.....(((((((.,..{{,.((((......)))),,...{(((..((((((....))))))..))))})))))))..)))))..),,)))))},{||.,,,,})))),.}))},,,,.)))))))))))....{{(((,|{{...........)}}.}))}},|,,((((((.,,.(((.(((.{((,(,,.,,.,,,|,,,..{{{||||...(((((.(((({..(((((.(((....)))))))))))))...)))))..))))))),}}.|||.,,,.,,},))..,((((((....))))))|,..........}}.....}}}}},.......})))}}),,))))))).))))))),...((((......)))),}))).)))))))))))..))).))}}}|(((((.(((((.(((.{(...((((((...)))))).)).)))))))).)))))|..,,{{(((,,.,|||..,|{{{{{,,......))))),((((({....))))))..))))))).))))))}.},.......)))).)))..)))))))))).....(((((.,{{,,..,}}.,,...)))))....,(((({{{{{.(((((..(((.(((((((.(((((((((.((((.((((...)))))))))))))))))((((((........)))))))))))))..))).)))))..))}|||,|||}.....,({((((((..((({.(.(((.((.....))))).)))))..))))))})},,,,)).))))))).)))))),...,,|||{.(((((((((((.(...).))))).)))))).}))).))))))).)))).))))).||||||||...,{{..{((((.(((((.{.{{{((((((.(((.(.(({{{...((((((((((((....(((((......)))))..))))))}..((((..(((......))).)))),))))).))))..).))).)))))){{{|,||,|||,...,},}}})}))}))}),),}))))))))),,)}...{{,,,((.....)))}}}}},)),..}}},,)))))}})),...})))))..})))))..))))))).)))}.}..)))),))})),}}}.,)})))),..}},)}})}||,.(((.,...}}}.))}}}},.....,.))))))))}..))))))..))))))))(((.....))),,...,.|,..,{,.{((..((((((..{{,(((,,(((({({(.{,,.{{,((((({.........)})))))}})))})),,.,}))},,),)}}))}}}},)))}}.,)))},.,,,}.))))))))))..))))))...,,,.,,....},.,,,|(((((.((((({.........)).))))...))))){(({.{.,,{{(((...{(({.(({....))).})))...)))),}},.}))))...

Transcripts

ID Sequence Length GC content
AAGCUUACUCAGCGCAUCUGCUACAGCAUUUUAUCUUCCCAAGAGCCCC… 4433 nt 0.5682
Showing 11 to 11 of 11 entries
Summary

Phosphatidylinositol 3-kinases (PI3Ks) phosphorylate the inositol ring of phosphatidylinositol at the 3-prime position, and play important roles in cell growth, proliferation, differentiation, motility, survival and intracellular trafficking. The PI3Ks are divided into three classes: I, II and III, and only the class I PI3Ks are involved in oncogenesis. This gene encodes the 101 kD regulatory subunit of the class I PI3K gamma complex, which is a dimeric enzyme, consisting of a 110 kD catalytic subunit gamma and a regulatory subunit of either 55, 87 or 101 kD. This protein recruits the catalytic subunit from the cytosol to the plasma membrane through high-affinity interaction with G-beta-gamma proteins. Multiple alternatively spliced transcript variants encoding two distinct isoforms have been found. [provided by RefSeq, Oct 2011]

Forensic Context

A study in mice demonstrated that the PIK3R5 (Pik3r5) was continuously upregulated in heart tissue following cecal ligation and puncture-induced sepsis and was localized at the center of a key gene co-expression network [Yan et al. DOI:10.3389/fphys.2022.903164].