| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACCACUUCUCUGGGACACAUUGCCUUCUGUUUUCUCCAGCAUGCGCUUG… | 578 nt | 0.4481 |
Enables IgG binding activity; aspartic-type endopeptidase activity; and identical protein binding activity. Involved in several processes, including detection of chemical stimulus involved in sensory perception of bitter taste; negative regulation of T cell apoptotic process; and proteolysis. Located in extracellular space and nucleus. [provided by Alliance of Genome Resources, Jul 2025]
A review of forensic proteomics literature notes that the PIP is a protein marker for donor profiling, specifically showing age-dependent expression changes in oral fluid [Alex et al. DOI:10.1016/j.scijus.2025.101320].