| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCCUUCCUCCUCGUCCUUUAGCCGGGAGCCUGUCUUUGCUUGCCUUUGC… | 2169 nt | 0.5182 |
Enables L-pipecolate oxidase activity and sarcosine oxidase activity. Involved in L-lysine catabolic process to acetyl-CoA via L-pipecolate. Located in peroxisome. [provided by Alliance of Genome Resources, Jul 2025]
A study in Apoe-/- mice demonstrated that the peroxisomal enzyme pipecolic acid oxidase (Pipox) was downregulated in the liver following cigarette smoke exposure, an effect associated with dysregulated bile acid and lipid metabolism [Lo Sasso et al. DOI:10.3109/08958378.2016.1150368]. A study in Apoe-/- mice demonstrated that cigarette smoke exposure induced significant proteomic alterations, including the downregulation of the peroxisomal enzyme pipecolic acid oxidase (Pipox), which is involved in lipid and bile acid metabolism [Lo Sasso et al. DOI: 10.3109/08958378.2016.1150368]. These molecular changes, part of a broader dysregulation of metabolic networks, were substantially reduced in mice switched to a candidate modified risk tobacco product or after cessation, indicating PIPOX's responsiveness to exposure changes.