| ID | Sequence | Length | GC content |
|---|---|---|---|
| GUUCCCCAGCUCUCCCGGGACGAAGCGGGCCCGCCAGCGAGUCGCAGUC… | 19969 nt | 0.3995 |
Predicted to enable signaling receptor activity. Predicted to be involved in immune response. Predicted to act upstream of or within sensory perception of sound. Predicted to be located in cytosol; extracellular space; and membrane. Implicated in autosomal recessive nonsyndromic deafness. [provided by Alliance of Genome Resources, Jul 2025]
A study in human cardiac tissue from ischemic cardiomyopathy patients demonstrated that the PKHD1L1 gene, which encodes a tumor suppressor inhibiting proliferation and cell invasion, was strongly decreased in lymphatic endothelial and endocardial cell nuclei compared to non-failing controls [Simonson et al. DOI:10.1016/j.celrep.2023.112086].