| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACUCAGGAUAAGACUUUCUCUAAGUCCGGAGCUGAAAAAGGAUCCUGAC… | 2699 nt | 0.3883 | |
| ACUCAGGAUAAGACUUUCUCUAAGUCCGGAGCUGAAAAAGGAUCCUGAC… | 2879 nt | 0.3904 |
This gene encodes a member of the cytosolic phospholipase A2 group IV family. The enzyme catalyzes the hydrolysis of membrane phospholipids to release arachidonic acid which is subsequently metabolized into eicosanoids. Eicosanoids, including prostaglandins and leukotrienes, are lipid-based cellular hormones that regulate hemodynamics, inflammatory responses, and other intracellular pathways. The hydrolysis reaction also produces lysophospholipids that are converted into platelet-activating factor. The enzyme is activated by increased intracellular Ca(2+) levels and phosphorylation, resulting in its translocation from the cytosol and nucleus to perinuclear membrane vesicles. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015]
A study in humans demonstrated that the PLA2G4A gene is downregulated in subcutaneous adipose tissue during long-term weight loss (0 to 12 months) in weight losers [Bollepalli et al. DOI:10.1038/ijo.2017.245]. A separate meta-analysis in humans identified the PLA2G4A protein as a key hub protein in a neurodegeneration interaction network linked to mild traumatic brain injury, where it is involved in signaling pathways associated with the condition [Matyasova et al. DOI:10.4149/gpb_2021038]. A study in mice demonstrated that the PLA2G4A is expressed higher in microglia compared to monocyte-derived macrophages after spinal cord injury [Stewart et al. DOI:10.1186/s12974-021-02161-8]. In a human forensic autopsy case of fatal anaphylactic shock, RNA sequencing identified the PLA2G4A as an upregulated downstream mediator within the FcεRI signaling pathway [Nakao et al. DOI:10.1016/j.legalmed.2025.102772].