Basic Information

Symbol
PLA2G4A
RNA class
mRNA
Alias
Phospholipase A2 Group IVA CPLA2-Alpha PLA2G4 CPLA2 Phospholipase A2, Group IVA (Cytosolic, Calcium-Dependent) Cytosolic Phospholipase A2 Calcium-Dependent Phospholipid-Binding Protein Phosphatidylcholine 2-Acylhydrolase Lysophospholipase GURDP
Location (GRCh38)
Forensic tag(s)
Cause of death analysis Mechanical injury analysis Other applications

MANE select

Transcript ID
NM_024420.3
Sequence length
2879.0 nt
GC content
0.3904

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-735.80 kcal/mol
Thermodynamic ensemble
Free energy: -798.77 kcal/mol
Frequency: 0.0000
Diversity: 628.89
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((((.(...((.(((((....((((.(((.((......)).))).))))))))))).(((((((((((((((((((......))))))))......(((((..(((((((((....)))))((((((....)))))).((((((.(((..........))).))))))..........))))....))))).(((((((.((((.............)))).)))))))........((((((((((((((((((..(((((.(.((....))...).))))).)))..((((((..........))))))...((((....))))............((((((.......(((((.....)))))))))))...))))))...))))))))).((((....))))(((((((((((((...(((((..((((.((((.(((((.(.(((.(((((....((((((.(((........))).((((((((....))))))))..........)))))).....))))).))).).)).)))..))))))))..))))).(((.(((((((.(((..((.(((((((((......))).)).)))).))......))).))))))).))).......((((((((((((((.(((((((..(((....(((.(((((((((.......(((..((((((((..((((...((((((((((((((...))))).(((((...(((((((((.((....(((((.(((((((((.(((.((..(((((((((.....(((((((((((.(((((((((((((...(((((..(((((((((((((((..(((((.....((((....((......))...))))...)))).)...)))))))).))))))).................)))))))).)))))))).(((((((((.((........))))).))))))...(((((((.(..(((((((((.(....((((((((((.(((((..(((....((((((((...))))))))..)))..........((((((......))))))....((((((((((...((((((.((((...((........))...))))...))))))...))))....((((((....)))))).))))))........(((((...(((((..((((((.((((.(.......).)))))))))).(.((((((((((((((((((....(((((....)))))......)))))...)))))..)))))))).)....))))).))))).......)))))))))))))))....).)))))))))..))))))))........)).))))))))))).....((((((.(((((...)))))..............(((((((((((......))))).))))))...((((((((((((((((((((((((....(((..(((((.......((((.((..((((...(((.(((((...))))).)))......))))..)).)))).........))))))))..)))))))).....((((((..((((.((((...(((((.....)))))....))))...))))..))))))...........)))).)))))))).....))))..)))))).....((.((((((((.((((.(((.((((((((((.(((((..(((((.(....).))))).)))......((((((((((.((..((..(((......)))..))..))...))).)))))))..........)).))))))(((......))).((((...)))))))).)))))))...........(((((((((((((...(((((((....))).(((......)))))))...)))))))))))))(((((..........)))))((((((((...((((((.((....).).))))))))))))))..)))))))).))))))))))).)))))))))))))).))))).....))..))))..)))))))))).........)))..))))))((((.((((........(((((.((....))(((((((((.(((.((((((..((.....(((.((((.((((((.((((........))))...(((((((((.....((((...((((...(((((((((....(((((.....).))))))))..((((......)))).....)))))..))))..)))).....)))))))))....)))))).)))).)))..))..)))).)).))).))))))))).....((((((((.((.....)))))))))).)))))))))))))....(((..((((.....))))..)))......(((((........)))))..))))..)))))))))))......))))))))).)))...((((((..((((((((((((..((((((..(((((((..((((....(((((((....))))))))))).......(((........)))(((((((.....)))))))(((((....))))).)))))))..))))))))))))))).)))..))).)))(((((((((((((((...)))))))))..)))))).)))....))))))).))))))))))))))..............)))))))))))))...........))))))..).)))).......(((((((((....((........))..)))))))))).)))).......(((((((((.(((((((....))))))).)))...)))))).....................
Thermodynamic Ensemble Prediction
.,{{{,{,,.{(.(((((....((((.(((.((......)}.))).)))))))))}}.(((((((((((((((((((......)))))))).....{((({,{{{{,,........})))}|,|}|||.(((((((((((((.....({..((((((((..(((((.((.(((,{.(({,((((.....{{{{(((((((.(({,.,,..........}))).))))))}.((((.((((((((.,.(......,,,)))))))).))))..,|....{{{{.{{....}),)))}........{{{||.,....((((....)))).})))}..,}}.{{{{,,...}})).,,,......)))))))..,),)).)).))))).)))))))).}}.....)))))))))))))){((((,.{((((..((({.((({.{{,((,(.(((.(((({.,..((((({.||,.,.|{,.||,},((((({{(....)))})))}..}|,|,,..}))))),....))))).))).}.}).,}),.))))))))..}}}}|||}|,((((((,.(((.{((,(((((((((......))).)).)))).),,..,,.))).,))))))})},,......((((((((((((((.(((((((..((,{(({{,,.,{{{(((((.......(((..((((((((..((((.{,(((((((({{((((...}}}}}.(((((...(((((((((.({....(((((.{((((((((.(((.((..(((((((((..{{{..(((((((..{{{(((((((((((...{((((..(((((((((((((((..{((((.....((((....{(......}}...))))...)))).)...))))))))}})))))).,,.....,........}}}))))),}))))))).(((((((((((,.......}))}})}})))))...(((((((.(..(((((((((.(....((((((((({,(((((..{((....((((((((...)))))))).,))).|,.......((((((......))))))....((((((((((..,((((({.,,((,..,....((,...}))..,}}...)})))),,.)))}....((((((....)))))).))))))..|.....(((((...(((((..((((((.((((.(.......}.)))))))))).(.((((((((((((((((((....(((((....)))))......))))}..,)))))..)))))))).)....))))).)))))..,,...}))))))))))))))....}.)))))))))..))))))))..{{{.,,({{((.(((((((((((..,(((((((((({...}))))........,,....(((((((((((......))))).))))))....|},{(((((((((((((((((((.,..{{(,.(((((.......{(((,,,,{((,,...(((.(((({...))))).)))..,,..)},}.,))})}}}........,)))))))),.)))))))).....((((((..((((.((((...(((((.....)))))....))))...))))..))))))...........}))),}))))))}{{{.{{.(({.....,,}}}.,})),..)))))).}..)).))))))))).)).}))..}))}}}))))))},.,,.|{{{{,......(((((({(((.{({.{,..,,,......,,,,,),,,},,,.))}.}}))))).}},,....,,}.(((((....))))){{{{{{{((,,.,.))))},,.,}}}}.,,,|{||{{||(((((((((((((...(((((((....))).(((......)))))))...)))))))))))))(((((..........)))))((((((((...((((((.{(....}.).)))))))))))))).,)))))))}}..))))))))).)))))))))))))}.))))).....)}..})))..))}}}))))}....,,,,,}))..}))))},|,{,|,,,|||{{{{(((({{.{(,,..}}(((((((((.(((.((((((..((.....(((.((((.((((((.{(((........}}}}...{((((((((.....{(((...((((...(((((((((....((((,.....}.))))))))..{(((......)))}.....)))))..))))..,))).....))))))))}...,)))))).)))).)))..))..)))).)).))).))))))))).....((((((((.{,.....},)))))))).||}||||,.....,}}}|||..||||},,}}}))),}),,....,,(((((........)))))..))))..)))))))))))......)))))|||((((((((((({{{..((((((((((((..((((((..(((((((..((((....(((((((....)))))))))))..,....{{{.,....,,}}|(((((((.....)))))))|,|{{,....,,}},)))))))..)))))))))))))))},)).,||}.|||..,{||||||||,|,})))))))))))),...}))))}}....))))))).))))))))))))))..,,,,.,{||,......}}},..,}}.,,,.,,....))))))..).)))),..{{{{(((((((((....((........))..)))))))))}})))}.......{{{((((((,((({(((,...,}}}))}.})}.,})}}}}}......,..............

Transcripts

ID Sequence Length GC content
ACUCAGGAUAAGACUUUCUCUAAGUCCGGAGCUGAAAAAGGAUCCUGAC… 2699 nt 0.3883
ACUCAGGAUAAGACUUUCUCUAAGUCCGGAGCUGAAAAAGGAUCCUGAC… 2879 nt 0.3904
Summary

This gene encodes a member of the cytosolic phospholipase A2 group IV family. The enzyme catalyzes the hydrolysis of membrane phospholipids to release arachidonic acid which is subsequently metabolized into eicosanoids. Eicosanoids, including prostaglandins and leukotrienes, are lipid-based cellular hormones that regulate hemodynamics, inflammatory responses, and other intracellular pathways. The hydrolysis reaction also produces lysophospholipids that are converted into platelet-activating factor. The enzyme is activated by increased intracellular Ca(2+) levels and phosphorylation, resulting in its translocation from the cytosol and nucleus to perinuclear membrane vesicles. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015]

Forensic Context

A study in humans demonstrated that the PLA2G4A gene is downregulated in subcutaneous adipose tissue during long-term weight loss (0 to 12 months) in weight losers [Bollepalli et al. DOI:10.1038/ijo.2017.245]. A separate meta-analysis in humans identified the PLA2G4A protein as a key hub protein in a neurodegeneration interaction network linked to mild traumatic brain injury, where it is involved in signaling pathways associated with the condition [Matyasova et al. DOI:10.4149/gpb_2021038]. A study in mice demonstrated that the PLA2G4A is expressed higher in microglia compared to monocyte-derived macrophages after spinal cord injury [Stewart et al. DOI:10.1186/s12974-021-02161-8]. In a human forensic autopsy case of fatal anaphylactic shock, RNA sequencing identified the PLA2G4A as an upregulated downstream mediator within the FcεRI signaling pathway [Nakao et al. DOI:10.1016/j.legalmed.2025.102772].