| ID | Sequence | Length | GC content |
|---|---|---|---|
| CCUUCAGCAUAAAAGCUGAUCCACAAACAAGAGGAGCACCAGACCUCCU… | 758 nt | 0.5303 |
Retinoids exert biologic effects such as potent growth inhibitory and cell differentiation activities and are used in the treatment of hyperproliferative dermatological diseases. These effects are mediated by specific nuclear receptor proteins that are members of the steroid and thyroid hormone receptor superfamily of transcriptional regulators. RARRES1, RARRES2, and RARRES3 are genes whose expression is upregulated by the synthetic retinoid tazarotene. RARRES3 is thought act as a tumor suppressor or growth regulator. [provided by RefSeq, Jul 2008]
A study in human traumatic brain injury (TBI) patients demonstrated that the PLAAT4 was identified as one of the four most significantly down-regulated mRNAs in brain contusion tissue compared to adjacent control tissue [Yang et al. DOI:10.4103/1673-5374.247467].