| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACAGUGCGGAGACCGCAGCCCCGGAGCCCGGGCCAGGGUCCACCUGUCC… | 2628 nt | 0.5381 | |
| ACAGUGCGGAGACCGCAGCCCCGGAGCCCGGGCCAGGGUCCACCUGUCC… | 2315 nt | 0.5292 | |
| ACAGUGCGGAGACCGCAGCCCCGGAGCCCGGGCCAGGGUCCACCUGUCC… | 2343 nt | 0.5280 |
This gene encodes a secreted serine protease that converts plasminogen to plasmin. The encoded preproprotein is proteolytically processed to generate A and B polypeptide chains. These chains associate via a single disulfide bond to form the catalytically inactive high molecular weight urokinase-type plasminogen activator (HMW-uPA). HMW-uPA can be further processed into the catalytically active low molecular weight urokinase-type plasminogen activator (LMW-uPA). This low molecular weight form does not bind to the urokinase-type plasminogen activator receptor. Mutations in this gene may be associated with Quebec platelet disorder and late-onset Alzheimer's disease. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Jan 2016]
A study in rats demonstrated that the PLAU gene (Plau) was significantly upregulated at 1, 4, and 7 days after spinal cord injury [Li et al. DOI:10.4103/1673-5374.255994]. In a separate study in porcine skin, the PLAU (PLAU) was significantly increased at 7 days postexposure to both sulfur mustard and thermal burn injury, where it was identified as a potential therapeutic target influencing wound healing by degrading extracellular matrix proteins [Price et al. DOI:10.080/15569520903097754]. A study in humans demonstrated that the PLAU exhibited a Gini impurity score of 0, being present in most pure urine samples and in some mixtures containing urine while being absent in mixtures without urine, classifying it as a discriminatory protein for urine identification in forensic body fluid analysis [Shehata et al. DOI:10.1016/j.fsigen.2025.103343].