| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGAGCAGAGGGUGUUGUGAGCAUAAAACACUGGAGGCGGCACUGCCCCG… | 2698 nt | 0.5982 | |
| AUUCAGGUCCCUGCACCGCACUCCGCUCGGACCCCAGGCCGCCGGUGCU… | 2651 nt | 0.5994 |
This gene encodes a member of the phospholipase C family. Phospholipase C isozymes play critical roles in intracellular signal transduction by catalyzing the hydrolysis of phosphatidylinositol 4,5-bisphosphate (PIP2) into the second messengers diacylglycerol (DAG) and inositol triphosphate (IP3). The encoded protein functions as a tumor suppressor in several types of cancer, and mutations in this gene are a cause of hereditary leukonychia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
A study in human postmortem brain tissue demonstrated that the PLCD1 was dysregulated at both the RNA and protein levels in the dorsolateral prefrontal cortex of subjects with opioid use disorder compared to non-psychiatric controls, as identified through integrated RNA sequencing and proteomic analyses [Mendez et al. DOI:10.1038/s41380-021-01259-y]. This multi-omics analysis, integrating RNA sequencing and proteomics, identified the PLCD1 as one of four genes with convergent dysregulation, implicating it within broader angiogenic gene networks and cytokine signaling pathways found to be altered in OUD.