Basic Information

Symbol
PLIN2
RNA class
mRNA
Alias
Perilipin 2 ADRP Adipose Differentiation-Related Protein Adipophilin ADFP Perilipin-2
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis

MANE select

Transcript ID
NM_001122.4
Sequence length
1897.0 nt
GC content
0.4760

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-591.70 kcal/mol
Thermodynamic ensemble
Free energy: -626.81 kcal/mol
Frequency: 0.0000
Diversity: 535.10
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((...((.((((.((((....((((((....))))))..)))))))).))...))((.((.(((((((..((((.((((((((....))))))))..))))..(((((((((((((.((((..((((((......)))))))))))))).)))).....(((((.((.......)).)))))...(((.(((.((((((.((((..(((((((.........)))..)))).))))))))))))).)))))))).((((((((((((((..(((.(((....((((((..(((((((....((((((((.(((((..((((...(((((.((((....(((.((((.....)))))))...(((.((((((.(...(((...((((((.(((((.(((......)))((((((((..((.....(((((((((..((((((.........((.(((.....))).)).((((((..(((((((((((...((((........(((((.((((((........((((..(((..(((((((((((((.....((((.(((((...((((....))))..))))).))))((((((........(((((((.(((...((((.(((.....))).).)))....)))))))))).((((......))))..((((.....))))..((((((((.(((....(((......))).....)))..)))))))).(((((..........((.(((((.((....)).))))).)).)))))))))))..((((......)))).(((((((.(((.......(((.........))).....((((((((((((..(((......(((.....(((((((.((((((((.......)).))).)))..)))))))......)))(((((((.......(((((((((.....))))))))).......))))))))))..))).))....)))).)))..))).)))))))....((((((((.((.....(((........))))).))))))))...)))))...))).)))))))).)))))))))).)))))...)))).)))))))..))))...((((.((((.......(((((((.(((((((((.((((((...((.((((((((..((((((.((((...(((((((..............)))))))...)))))))))))))..........))))))).)))))).))...........)))))...)).))).)))).....)))))))).))))))((((((.(((((.(..(((.(((((.(..(((((..(.(((...........))).)..)))))..)..))))).)))..).))))).))))))...........))))))..)))).)))))..))..))))..)))).((((((.....))))))))))).....(((.((((.((..(((......)))..))...)))).)))...(((((.((.((((.((((((....)))))))))).)).))))).....(((((((.(((.(((.(((.......))).))).)))..........((((((((....)))))))).))))))).))))))...........)))....).)))))).))).)))).))))).)))))))))....(((((...........))))).))))...))))...))))))).))))))....))).))).)))))........).)))))))).((..((((....))))...)).((.((((((.......)))))).))....((((((((.....)))..)))))..............))))))))).))........
Thermodynamic Ensemble Prediction
{{...((,{{((,({{(,,,,{{((((.,,,||||||,.||||||}|,}}..,||((.((.(({(((({{({{,.((((((((....)))))))).,|||}..|||||((((((((.((((..((((((......))))))))))))))}})))...,{(((({.,{,,.....|}.},)}}|,.(((.(((.((((((.((((..((((((({{....}}.}))..)))).))))))))))))).))),}}||.(((({{{{,{{|||..{|(,(((,,,,(({((({{((((({{,.,,,{((({(({,((((,.((((..{(((((.((((....(((.((((.....))))}}}.,,(((,((((((.{...{{{,,.||||{{.,,||{.,{{,,,,,,}}|{|||((((..((.....(((((((((..((((((...,,,,..((.(({.....})).)).((((((..(((((((((((...((((.....,..(((((.((((({.......,((((..(((..(((((((((((((..{{((({{.{{{||}}}{{((,...||||.{||||,,|||||,((((.,(({.,.(((((((.(((...((((.(((.....))).}.)))....)))))))))}{((({({{(((,,....((((.....))))..((((((((.{{{....({{......})}.....)))..)))))))).{{.,({,.{{{....,,.{{|||,||..,,,)})))))}))((((((...((({{((((......)))).....}}.))).....))))))..((......)).....,,.,,,,}})},)))}}...,}}}}|}}}}}||{}}},.}}}}.})))),....))}}}||||)|}},((((,...{((({.,((((((.......(((((((({.....))))))))).......)))))))}))}.}..}}}}.|||,|,|||,.,}}|||||.,,||}},,{(((({{.{,...,,(((........))))}.))))))),,,})))))..}))).)))))))).)))))))))).)))))..,)))).))))))),.})))...{{{..((({,(,...,(((((((.(({{{{({{.((((((.{,{{,{(((,(((..((((((.((((...(((((((...{.......,..)))))))...))))))))))))).},,..||{{|,,,,}),))}}}},}}}||||,..,,,)}}))}..,,.)))})))).,..,)))))))).)))))){(((((.(((((.(..(((.(((((.{..(((((..(.(((...........))).)..)))))..}..))))).)))..}.))))).)))))}..,........))))))..)))).)))))..))..))))..|||||((((({.....)))))),}}}......{((.((((.((..(((......)))..))...)))).}))...{{{{(.({.{{{{.{(((((....)))))))))).)).)))))..||||||||{{.{,{|(((,{{{..||||.},,.|||,|,,..........((((((((....)))))))).)))))}}}},}||}.....}}....))),,..},)}}})).}}).)))).)))))}})))))))}}|.,|{{{{,,,....,,,.,}}}}..,,,,,}))))},}))))})),)}}))),...))}.})),)))})||,...}}),)}))))}),||,.{(((....))))|,,||.{(.{(((((.......)))))}.)}.,{,{.....||}},.........|(((({......})))))}})))))}.}),,,.,,,.

Transcripts

ID Sequence Length GC content
GCUUUGACCGGGUCGUGGCAGCCGGAGUCGUCUUCGGGACGCGCCUGCU… 1897 nt 0.4760
Summary

The protein encoded by this gene belongs to the perilipin family, members of which coat intracellular lipid storage droplets. This protein is associated with the lipid globule surface membrane material, and maybe involved in development and maintenance of adipose tissue. However, it is not restricted to adipocytes as previously thought, but is found in a wide range of cultured cell lines, including fibroblasts, endothelial and epithelial cells, and tissues, such as lactating mammary gland, adrenal cortex, Sertoli and Leydig cells, and hepatocytes in alcoholic liver cirrhosis, suggesting that it may serve as a marker of lipid accumulation in diverse cell types and diseases. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2011]

Forensic Context

A study in humans analyzing heart tissue samples from patients with structural heart diseases identified the PLIN2 as a differentially expressed gene, showing it was down-regulated in diseased samples with a mean fold change of 0.5383 and an adjusted p-value of 3.3583 × 10^-25 [Fajarda et al. DOI:10.1186/s13040-020-00217-8].