| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCUUUGACCGGGUCGUGGCAGCCGGAGUCGUCUUCGGGACGCGCCUGCU… | 1897 nt | 0.4760 |
The protein encoded by this gene belongs to the perilipin family, members of which coat intracellular lipid storage droplets. This protein is associated with the lipid globule surface membrane material, and maybe involved in development and maintenance of adipose tissue. However, it is not restricted to adipocytes as previously thought, but is found in a wide range of cultured cell lines, including fibroblasts, endothelial and epithelial cells, and tissues, such as lactating mammary gland, adrenal cortex, Sertoli and Leydig cells, and hepatocytes in alcoholic liver cirrhosis, suggesting that it may serve as a marker of lipid accumulation in diverse cell types and diseases. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2011]
A study in humans analyzing heart tissue samples from patients with structural heart diseases identified the PLIN2 as a differentially expressed gene, showing it was down-regulated in diseased samples with a mean fold change of 0.5383 and an adjusted p-value of 3.3583 × 10^-25 [Fajarda et al. DOI:10.1186/s13040-020-00217-8].