Basic Information

Symbol
PLK1
RNA class
mRNA
Alias
Polo Like Kinase 1 PLK Serine/Threonine-Protein Kinase PLK1 Serine/Threonine-Protein Kinase 13 Polo-Like Kinase 1 EC 2.7.11.21 STPK13 PLK-1 Cell Cycle Regulated Protein Kinase Polo-Like Kinase (Drosophila) Polo (Drosophia)-Like Kinase EC 2.7.11
Location (GRCh38)
Forensic tag(s)
Wound age identification Sudden cardiac death diagnosis

MANE select

Transcript ID
NM_005030.6
Sequence length
2160.0 nt
GC content
0.5708

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-830.40 kcal/mol
Thermodynamic ensemble
Free energy: -864.94 kcal/mol
Frequency: 0.0000
Diversity: 553.38
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((((((((((((...((((((.((((...))))))))))))))).)))((((((((...))))(((((.((.(.((((((..((((..((((((((.....)))))))).))))...(((((((((.(((((((((((((((((((((..(((((..((((((.(((((((((....)))))..(((.....)))(((((.((.((((((((((((((.....))))))))))))))))))))))))).))))))...((((((((((.....))))))))))((((......)))).....(((((.(((.......))).)))))(((.......)))(((((....)))))...........)))))((((((((((..((.(...(((.(((.....))).)))...).))..)))))...))))).)))))))..))))))))))....)))).)))))))))((.(((((((...((((......(((.((((((.((((..((.((.(((......((((...(((...)))....)))).....))))).))...)))).).))))).)))))))..))))))).))......((((((((((((...(((...((((((((........))))))))...))).((((((............)))))).(((((...(((......))).)))))..(((((...........)))))(((((((((((((.......(((((((((((((((...))))))))....)))))))...)))))))..))))))((((......))))....)))))))))))).....(((((.......)))))..............)))))).).)).))))).((((((((((((...(((.(((((((((.............((((((........))))))..((((.....))))..(((.........))).((((((...((...((((((((((.(((((...((((((((.(((((.((((....)))).....))))).))))))))..........(((......(((((((((.....((((((((........))))........(((((...)))))......))))(((((((((.....))))))))).((((((..(((((...)))))..))))))....)))))))))....))).))))).)))))))))).)))))))))).)))).))).)))......)))))))))))).))))...((((((.(((((.(((.......(((((((((.....((((((((((....(((.(((((((.(((((...((((((....(((((((.(((((...((..(((....)))..)).....))))).)))).)))..)))))).....(((.((.(((((........)))))..)).))).))))).)))))))............))).)))))).))))..(((((((((...))))))))).........((((.((..(((((((((...(((.(((.(((...(((.........)))...))).)))..)))...)))))....))))..))..)))).(((.((((....(((.(((((((((......((((.....))))((((.......)))).((((...((.(......)))..))))(((((..((.......))..)))))))))))))))))....)))))))..((((((((....)))))))).......((((......))))....((((((((((....)))))).))))......)))))))))))).)))))))))))...)))))((((.(((.((......(((((((((((((...(((((..((((((..((((.((...)).))))......)))))))))))((((((.....))))))(((....)))........))))))))))))).(((.....)))...(((((((((.(((((((((.(((((.........................)))))))))...))))))))))))))...(((....)))...)).)))))))............(((.((((((.....)))))).)))...
Thermodynamic Ensemble Prediction
((((((((((((({{.{(((((.((((,,,||}||||}}|})))|.,})}}||||||...}||||(({{.({,(({{{(((({((((..((((((((.....)))))))).||||,{.(((((((((.(((((((((((((((((((((,{(({((..{{{{{{.(({,(((((....)))))..(((.....)))(((((.((.((((((((((((((.....)))))))))))))))))))))}}||,}}}}))||.((((((((((.....))))))))))((((......)))).....(((((.(((.......))).)))))(((.....,.)))(((((....)))))...,,}..,.,}}||{(((.(((((({{((.{...(((.(({.....})).))),.})}))..}))))).)))),).))))))}..))))))))))....)))).))))))))),..{{(((((..,(({{....,,((({((((({,{(,{,.,..((,(((.....,(((({{((.{{{{|||,|||}}}}.....||}||,|.,,,||}},|,}}|||.,}}||}}..,}}}})),,}..,},.{{||{{{{(({|...||,,||((((((((........)))))))).....,.{{{(((,,.,,.......}}|}}}.,(({{...||,......}}},)))),,}|||||,.}},.....{{{{{.(((((((((((((.,.....(((((((((((((((...))))))))....)))))))..,)))))),.,)))))),,,)))}}....||,.||}}})))}))}})..,,.,,,{(,,,,...}})))}},,}},},.....}))))}}||||{|}|||.((((((((((((...(((.(((((((({.............,,,{((.{{{{{..}},,,}..{|||,}...},,,..(((.........))).((((((...((...((((((((((.(((((...((((((((.(((((.((((....)))).....))))).)))))))).......,..(({......(((((((((.....((((((((......,.}}))........(((((...)))))....,.))))(((((((((.....))))))))).((((((..(((((...)))))..))))))....)))))))))....))).))))).)))))))))).))))))))}).)))),,)).))).,....)))))))))))).}}...|.||||||.{{{{{.{{{...,...||||{||||,.,,.((((((((({....(((.(((((((.(((((...((((((....(((((((.(((((...((..(((....)))..)).....))))).)))).)))..)))))).....(((.{(.(((((........)))))..}).))}.))))).)))))))............))).}))))).))))|.(((((((((...))))))))).........((((.(({,,({({{{{{,|||||.||||(((...{{{...,,....}}}.,.)}}.},|{,|||{|.,,}},{{((||||..||..,,))}|||}||||....,{{{(((((((((.,.,..,..({,{{{{,||{,,.....}}})}},,,,|||,.,..,.,,,||},|,.{((({.,.,..||......,)).,},))))))))))))))),,)))}))))}..((((((((....)))))))){|...|,((((......))))....((((((((((....))))))}})))....},)))}})))}})}.,}}})))}})),}},)))})),))}))))}}.,,..,{|{{{{{{||||.{{((((,.{((((((..((((.((...)).))))......))))))),.))}|||||..}}}))))))))}})))||||.......))))|||||||||{{{({{{{{{|....,}})}||||.||,,(((,(.((({,..,,,....,},.,},}.,,},..,)))))))))....{{{{{,,,,|{{|...}}}}....))}))(({....))).,))).......{{,.((((((.....)))))).,},...

Transcripts

ID Sequence Length GC content
GGAGGCUCUGCUCGGAUCGAGGUCUGCAGCGCAGCUUCGGGAGCAUGAG… 2160 nt 0.5708
Summary

The Ser/Thr protein kinase encoded by this gene belongs to the CDC5/Polo subfamily. It is highly expressed during mitosis and elevated levels are found in many different types of cancer. Depletion of this protein in cancer cells dramatically inhibited cell proliferation and induced apoptosis; hence, it is a target for cancer therapy. [provided by RefSeq, Sep 2015] CIViC Summary for PLK1 Gene

Forensic Context

A study in Sprague-Dawley rats demonstrated that the PLK1 was identified as a key gene present in all four defined index systems (Sets A, B, C, and D) for wound age estimation following skeletal muscle contusion [Ren et al. DOI:10.1016/j.fsigen.2022.102722]. In a separate investigation of myocardial infarction in mice and humans, the PLK1 was identified as a potential target gene related to MI and cellular senescence through machine learning and PPI analysis, though its diagnostic value in external validation was limited [Wen et al. DOI:10.1038/s41598-025-94988-x].