Basic Information

Symbol
ATAD2
RNA class
mRNA
Alias
ATPase Family AAA Domain Containing 2 ANCCA AAA Nuclear Coregulator Cancer-Associated Protein PRO2000 CT137 ATPase Family AAA Domain-Containing Protein 2 DKFZp667N1320 MGC29843 MGC5254 EC 3.6.1.-
Location (GRCh38)
Forensic tag(s)
Cause of death analysis

MANE select

Transcript ID
NM_014109.4
Sequence length
5547.0 nt
GC content
0.3898

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1422.40 kcal/mol
Thermodynamic ensemble
Free energy: -1534.88 kcal/mol
Frequency: 0.0000
Diversity: 1738.06
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
....((((.....)))).((.(((..((((((.((((((.((((.(((.((.((((((((((((...(((((((((.((..((((........((((....)))).((((((...)))))).......)))))))))))))))..)).((((((((((....))))).((((.....)))).)))))....)))))))))).)).))))))).)..)))))..)))))......((((((((.......)))...))))))..))).)).....((((((.((((...((((............(((((((...((((((....)))))).((((...((((.((((.......))))))))...))))...............((((((...))))))..(((((..((.(.((((......)))).).))..))))).......)))))))......(((..((((((....))))))..))).(((((.(((...((((((((((........)))).....(((.......)))..))))))..))).).))))(((((((((.((....((((..((((((((....))).......))))).)))))).))))))))).....(((..(((((((((..((.((((((((........(((((((((((.......((((((..(((((...(((..(((((((((.........(((((((......))))..(((((((.(((((((..(((((((.....((((..((((((((...............((((...(((((((((.((((.........((((((....((((....(((....))).))))((((((((((((((((((((.((((..((.(((.((((((((.((.((....)).)).))(.(.(((((((((((((...((((((....(((..((((..((((.((((((....(((((((((.....)).))))))).......((((((((((......(((.......))).....))))...........(((((((..(((.((((((..((...(((((.....))))))).))))))..))).((((.(((((((....((.((..((.((....)).)))).)).))))))).))))(((((((.((((((.(((((.(((.((.....)).))).))))).))))))...))))))).....)))))))..((((((((((........(((((....)))))........)))))))))).................))))))...((((((.(((((((((..((((((.((.((((((...((((((((.(((((.(((...)))))))).))))...((((((((((...((((.((((((.....))))))))))....)))(((((((((((...........(((((.......)))))...((((((((((.(((((((.(((((((.(((.(((((.(((((.((((((......)))))).(((.((((((((..((.((((((((((((((((((((((.....((((((((..((..(((((.((((...(((((..((((((.......))))))(((((..((((..((((.....(((((((((..............)))))))))))))(((((.....))...)))))))..)))))......((((.((((.((((((.(((((((.(.(((.((......)).))))))))).)))))))).))))..))))............(((..((((.....))))..)))((((..(((((.(((((((((...........((((((((..........))))))))(((.....))).((((((((((.....((((((.((((....)))).)).))))....))))))))))...((((((((....(((.((((((.((((..((((.(((((.....))))).))))(((((.((.....)))))))((((((..((((((...((((((.......((((((((......(((((((......)))))))....))))).))).))))))...)))))).........((((.(((.(((((.....)).)))))).))))...(((((((...))))))).))))))((((..(((((((((.....(((............)))......))))).)))).)))).....)))).)))))).)))............(((..(((....))).))).))))))))))))))))).)))))...)))).((((......))))(((((((....)))))))...)))))..)))))))))...))...))))))))....)))))))))..)))...))))))))........)))).)))))))).)))(((.....))).......(((((((..(.......)..)))))))..))))))))))..))).))).......((((..(((((.(((....))).))))).))))..((((((..(((((.......)).)))...)))))).)).))..))))))).)))))))))).....(((((((((........)))).)))))((((((((((((((((((((((((.(((((.........((((((((...((((((...................(((((((((.(((.(((((....((((((.((((((.(((((........).)))).))))))...))))))...(.((((((((((((..((((.(.........).)))))))).)))))))).)))))))))))))......)))))..((((((((...(((.((((.((..(.(((((..............(((.((((((.((((((((.(((.((......)).))).)))...)))))......(((((..(((((.(((((......)))...........((((((((.(.(((((....))))))))))))))......(((((((.(((((((((.....((((..((....))..))))...)))))))))((((..((((.((....)).)))).)))).)))))))..................)).)))))..))))).....((((((((((..((.(((..(((((.....(((((((.((........(((((...(((....))).)))))......))))))))).....((((..(((((((((((((((((((.((..((((((...))).))).))))))))).))))..........(((((........)))))..((.((((((((...(((.((....(((.((((...((((........)))).............)))).))))).((((.((((..(((...((((..((((..(((((........)))))....))))..)))).....))).........(((((((....((((((((.....((((..((....))..))))......)))...)))))....))))))).)))).))))...........)))..))))))))))..))))))))..)))).....)))))(((((..........)))))...(((....))).))).))..)))))))))).......((((((.((........)).))))))..................)))))))))(((((...((((....((((((.....))))))......))))....)))))...(((((...)).)))))))).)..)))))).)))..))))))))...(((((....)))))..(((.((.((.((((((((.((((..((((((((((((.................))))))))))))))))..........)))))))).)))))))))))))....((((((.......))))))....))))))))))))).))))))).)).))))...........)))))).))))).((((....)))))))))))))))))))))).....(((....))).((((........))))........))))..)).))))))....)))))).)))))))))))))))(((((((((...(((((.............(((((((((((((.....)))))..))))))))..))))).)))))))))....))))))))))..))))..)))))))))...))))))))))))).).)........(((((((.........)))))))...(((((.((((((((((..........(((((......)))))..((((((((((.(........).)))))))))).((((..((((.(.((((((.(((..(((.(((((((...........((.((.((((.((((.(((((........(((((..(((....))).....)))))))))).)))))))).))))..........))))))).))).))))))))).)))))..)))))))))))))).))))).........(((((.((((.....)))).)))))........))))))))).))..)))).)))))))))))))))))))).......)))))))))))).)))))))..)))).(((((.(((..(((((((((..((((((((((((.((.(((.((...((((...(((....))).))))...)).))).)))).)))))(((((((......((((((...))))))..(((((((((((((......))))).))))))))..(((((........)))))....((((......))))(((((..((((...((((..(((((((..................)))))))..))))...))))...)))))........(((.((((.....)))).))).....))))))).((((((........))))))...........((((((((....((((............))))...))))))))...(((((......))))).))))))))))))))..))))))))((((....))))....)))))))).)))).....))))))).....)))))))...(((((..(((((..((((.....))))...)))))..)))))(((((((((((....))))))))))).....((((((.((..((((.((((..............)))).))))..)).)))))).........)))))))...(((((((....((((......))))....)).))))).......(((((....))))).))).......)))))))))..)))...)))))........))))))......)))))))))))...........)))))))).)).)))))))))..)))...........))))...)))).)))))).
Thermodynamic Ensemble Prediction
....,,,(((({{(((,.(({(((.{(((.({.{,,,{|},|||},,({(({(((((((((,{{...,,||,||||.....||||}}..}}}.,|||}}}})))).((((({...)))))).....,.,,||{.|||,,,,))}.))}|||||..(,({.{((((.((((((((((.{{.((((||{.(((((((((..|.|})}||||||.{||.|||{|.{|{..,......{{|||{||}.}}...)))..,))))))))))},)).,)))}|.))))))),.....,...}}}.))}}}.||{|{{,...((((((....)))))).((((...((({{((((.......))))))))...))))........,}}}|..((((((...|}}}}},.,,,,....{|{.{{{{|,||,,||||||||||..............,|||,|...{{.(((..((((((....))))))..))).}|,,,}|||...,,{,{{((((........))))..{{,{((.,..,,,|||.{|||||}..,,,})}))}.{|{{||{{{.{|....||||||||{,|,||||,,},)}},,,.})))))))),},.,)}}}}}}},.....(((..(((((((((..((.((((((((...,.,,.((((((((((((((((((((({({(((,,,,({..((({{((,(,(((((.(((..{((.{(((.{{....,,,..(((((((.(((((((..(((((((,(.{(((((..((((((((..{{{,....,{,,.,.{{,,,{((((((((.((((.,.......(((((({,,.((((....({(....})}.}))}((((((((((((((((((((.((((..{(.(((.(((((({{.{{.{{.,,.|}.||,||({(({{((((((({(({,,,,((((({(,,{,..{{{{,(((.{((,,,....{{{{,,,,||||....})).)))})).}}.....,|||||||{,......{{{.......}}}..,{{{{...,,..{(((((((((,,..(((((((((((..(,..{(((((.....)))))),.)))))}...,)}}))|,|||||||}},.,..||..,{,((,..,||,||,,.,,,{{||,|||||||(((((((.((((((.(((((.(((.((.....)),))).))))).))))))...))))))).....||||},},.((((((((((........{((((....},))},,,,,...))))))))))...,.{{.{{{....}})|)}||...((((({{(((((((((..((((((.(({((.((({{{{{,.((({.(((((.(({...|))))))).}))).,,{{,{{,((({...||||,{(({{{,,...}))}}}||||,,..{,{((({((((((,.,{{{..,{,,(((((,....|.))))},{|((((({{(((,((({(((,{(((({{.{,,{(((({{(((||,((((((......)))))).{((,{(((((({...,,.(((((((((((.....))))))))))|,||{|||..{{,..{,((((((....(((((.(((((((.......)))))))..}}}}|||}}}},{{||,..{{{{{{{{{.,,|,,.,.)),..}}}||||}|||||{{,,|}}.,,})}}}},||))),.}}})}||,}|.||||}|||,.((((((.(((((((.{.(((.{(......)}.)))}))))).)))))))).)))}||..{(((((({.({{(.(,(((((((({...,.{|{{|{{{(((,.(((((.(((((((((..........,|((((((({{{,.,,,.....,}))))|,..}}}))).((((((((((.....((((((.((((....)))).)).))))....))))))))))...((((((((...,{((,{(((((.((((((((((.(((((.....))))).)))){((((.((.....)})))||((((((..((((((,..{(((({.......{(((((((...,..(((((((......))))))}....))))},))).)))))).,.)))))).........((((.{{,(((({({....,)}))))}}.))))...(((((((...))))))).))))))|},...(((((((((.....{{|,,,,.......,}}}.,,...))))).))))...}})}},,)))).}))))}.}},............(((..(((....))).))).))))))))))))))))).))))).,.)))}{((((......))))|(((((({,..,,|||}|{{,.,,))},))),,)))),,||}...||||,,,,,{{{|,{|{||,,.{{||{.{||,|||.|{{....}}}.,,,},))).))})}..}}))}.,}})}.})))))|,,,,,}}}}}}}}}.)..,)))),,..,)))))))||||}||,|||.,|||{,(({,..(((((.(((....))).))))).}}}}{{{(((((,,({{{{,.,..,{,|,}|}||||}|}..,},.|}|,}}||}}}.}}||||}}}}..,{.(((((((((........)))).)))))||{{{{{{{{{{{({((((({.,..{((((,...,,,..|{,{{{||...{{{{||.,,,,,,,..{{{,,..,.(((({((((.(((.(((({....((((((.((((((.((((,........).)))).))))))...))))))..,(.((((((((((((..((((.(.........).))))))))}}))))))).)))))))))))))......)))))..,{,{||||...,{{,(((({(..,{,{{{,...........,..,|||,|,,}}}.(((({{((.({(.{{...,,,)},,}),))),,.)))))..,...||||,.,|||||.|||||}.,.,..},.....,,,...((((((((.(.(((((....)))))}))))))))......,|||,,,.(((((((((.,,..((((..((....))..)))),}.)))))))))||||.,{{{,,((|,{,||,|||,.}|}},|||,,,..,}},.,,...}},,|||||||||||,.|||||.....|{{((({(((.,(({(((..{,{{{.....{||||||.,||||,,,{|(((,{||{(||||,.}},.}}}},.},,..||))))),,,,}},{({(..{(({(((({{({(((((((.((..((((((...))).))).))))))))).}}}}..,,|,.,..{{{,|,,}},.}}))},}..{{.{{{{{{{,...|||}|}..{||....}},...((((........))))......,,,...{{{{{,{,....,|||,{|{{..{||...{{((..((({.{{{||(|,,.....))))}..},)))),,)))),...,))).....,,,,(((((((,,,,((((((((,{...((((..((....))..))))....,.))}...})))}...,|||}}}}.})}}.}}},.....}.,,,}},,..})))})}|}|..}}}}}}}}..)))}..,,,}...|(((((..........)))))...(((....))).,,}.,,..)))))))))}...,,,.,||||...,,},))||,||{||||}},................,|||...,))||||{...{{{{....|||||{.....},,)))},,.,,))})....)))))...}.}}}})))))})))))},.|,,|||}||,}||,,|||,|||||,,(((((....)))))..(((.((,({.((((((((.((((..((((((((((((.................)))))))))))))))).,,.......)))))))),)))})))}}}}},.,..((((((.......))))))....||||}}|},,,,}.,,)),})))}},,,,.,,}},..,.}))))}}.}}}}}.{{{{....})))})})}}}||||||||,.......|||,....}}}||||,..,,||.}}}),,...,}}))))}},}}}.}).,,,..)))))).)))))))))))))))(((((((((...(((((.............(((((((((((((.....)))))..)))))))),.))))).)))))))))...((((((.....)))))),}}})}})))}..}))))),)))))))})},,},,....(((((((.........)))))))...,((((.((({((((((,,.,......,{|{|,,,,.,})))),,{(((((((((.(........).)))))))))}.|{{{..|||||{.{{{{{{.,{{,,{((,((((((,.,,......,|||,||,||,,|,.{{{.{{{({.,,,...,|)}})}.}}},}}.||||||,,,})},,}}..||||,,.,}}}}.,,.,,.....})))}}).))),},,)))))),)))))..)))))))))))))),))))),..,,....(((({.((((.....)))).}))))........))))))))).}),.)))).))))))))))))))))))))}}},...}))))))))))).))))))).,,,||{(({,,{({{{.(((((((((.,({((((((((({.((.{{(,{(...{{||..,|{,.,.,})),))))...)),))}.}))),}))))|{{{{{{{{{{..{{({{{...}}}}}}..(((((((((((((......))))),,)))))))..,...,..,,.,{{|||{{{...,|||,.....,},,{{{{{..{(((...((((..((((((({,,,......,,,.....)))))))..))))...)))}.,,)))))}}},....{{{,{{{{.,}}})},,.}}},,,.,||}|||,.,{{(((,.......|||}||,|,,,,..,,,|||,||||}}},||||},},},,....,},}}.,,}}}}}}},.,,(((((,.....}}))),},))}))))))))))))),,))))||,,....))))....)))))))).))))})}.)))))))).....))))))),,,(((((..(((((..(({(,....}})),,.)))))..))))}(((((((((((....)))))))))))...,.((((((,((,.((((.{(((..............)))).)))),,)).))))))}},......)))))))}}.}}}|.}}}...,|}}.}})}}.),)})}))..})}},.......,,,,,....}}}}},,||,.....,,..}))))}}.)))))))|||||....,,,,....,.}}}..))))))))))).......,...)))))))).)).)))))))))..))).......,...,||},...,})}))),,..

Transcripts

ID Sequence Length GC content
AGAAUUCGGAGCGCGGAAGAGCCAGAGCUGCGAGCGCCUGGAGCUGGAU… 5547 nt 0.3898
Summary

A large family of ATPases has been described, whose key feature is that they share a conserved region of about 220 amino acids that contains an ATP-binding site. The proteins that belong to this family either contain one or two AAA (ATPases Associated with diverse cellular Activities) domains. AAA family proteins often perform chaperone-like functions that assist in the assembly, operation, or disassembly of protein complexes. The protein encoded by this gene contains two AAA domains, as well as a bromodomain. [provided by RefSeq, Jul 2008]

Forensic Context

A study in cultured human aortic endothelial cells demonstrated that the ATAD2 mRNA was one of eleven most-significantly regulated transcripts at 24 hours post-irradiation, functioning as a marker to differentiate unirradiated (0 Gy) samples from all irradiated doses (1-10 Gy X-rays) [Chopra et al. DOI:10.1038/s41598-022-24051-6].