| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACUGGGCGGACCGCGGCGGCAGCAUGAGCGGCGCAGACCGUAGCCCCAA… | 958 nt | 0.6545 |
The product of this gene catalyzes the last step of the catecholamine biosynthesis pathway, which methylates norepinephrine to form epinephrine (adrenaline). The enzyme also has beta-carboline 2N-methyltransferase activity. This gene is thought to play a key step in regulating epinephrine production. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Nov 2012]
A study in rats demonstrated that the expression of the PNMT mRNA in adrenal glands significantly increased with the intensity of contusion stress (p < 0.005) and showed a pronounced time-dependent decrease with increasing postmortem intervals, particularly in the stressed group (p < 0.0001) [Takahashi; Shirushi DOI:10.1620/tjem.216.239]. In human forensic genetics, enzymes involved in catecholamine synthesis, including the PNMT, are discussed in the context of sudden infant death syndrome (SIDS) pathogenesis, with research confirming a significant association between a polymorphism in the tyrosine hydroxylase gene (TH01 allele 9.3) and SIDS occurrence (p = 0.038) [Courts, Cornelius; Madea, Burkhard DOI:10.1111/J.1556-4029.2010.01670.X].