Basic Information

Symbol
POGLUT1
RNA class
mRNA
Alias
Protein O-Glucosyltransferase 1 HCLP46 MDSRP 9630046K23Rik KDELCL1 MDS010 C3orf9 KTELC1 Rumi Myelodysplastic Syndromes Relative Protein Protein O-Xylosyltransferase POGLUT1 KTEL (Lys-Tyr-Glu-Leu) Containing 1 O-Glucosyltransferase Rumi Homolog KTEL Motif-Containing Protein 1 CAP10-Like 46 KDa Protein KDELC Family Like 1 MGC32995 CLP46 HRumi Chromosome 3 Open Reading Frame 9 X 010 Protein EC 2.4.1.376 EC 2.4.2.63 LGMDR21 LGMD2Z
Location (GRCh38)
Forensic tag(s)
Cause of death analysis

MANE select

Transcript ID
NM_152305.3
Sequence length
3508.0 nt
GC content
0.4051

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-964.90 kcal/mol
Thermodynamic ensemble
Free energy: -1031.69 kcal/mol
Frequency: 0.0000
Diversity: 1009.39
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((((.((.(((....)))..)).)))))(((((.((((((..(((((((((((((.(.((((((((((((....)))))))))))).).))))).((((((((((((((.(((((......)))))...((((((..((((((.....((((((.....))))))((((.........))))...((((((....((((...)))).((((((....((((((((.....((((((((((...(((((......)))))(((..((((....)))).))).(((((..(.(((((.(((((((.(((((.(((((.(((((...(((.((..........)))))....(((((.(((....))).))))).((((((((.((((.(....).)))).)))))))).((((((.((((((((((((((((.((.((((.(.(((..((((.(((......))).(((((((((..((((((......))))))..(.(((((((((((((((....((.((((..(((..((((((........((((((((((....(((((((..((((((((((((((.............))))..)))))))))).))))))).((((.((((((....(((((((((((.((((((((((.(..((((.(((((...((((........(((((((..(..(.......)..)..))))))).........((((((((((((((.....((((((...(((((.............(((....)))..((((((((..((((((((((.(........).)))))).))))..))..))))))..)))))...))))))....)))...)))))))))))..))))..)))))..(((......)))))))..).)))))).))))))))...(((....)))....((((.(((((...))))).)))).))))..))).((((..........)))).......)))))))))).)))))))))).(((.(((((...))))).)))..)))))))))..))))..))..)))))).))))))))).)......)))))))))...))))....))).))))).)))))))..)))))).......((((....))))....(((((.((((..........))))))))).((..(((((...)))))..))...............((((((((((((((((...(((((....)))))....)))))....((.((((((.(((....((((..(((((((...)))))))..))))......(((((((((((((...((((((......))))))((((((((((.((((.......)))..((((....))))........((((.....))))(((..((...))..))).......).))).))))))).........((((((.(((((..(((....))).))))).))))))(((((((.(((((.(((.((..((..((((((.((((..((((..((((.....)))).((((..(((((((..((((.(((((((.....(((((.(((.....))).)))))....))))))).))))..)))).))).)))).(((.((((.........))))..)))(((((....)))))...........(((((....))))).))))..)))).......))))))..))..)).))).))))))))))))((....))....(((((.((((((.(.((((.((((((..((((.((........)).))))..)))))).))))....((((((((((((((.((((((((((((((....))).)))))))))..........)))))))))))....(((((.(.(((((((...........(((((((((........(((((((((((..........(((((((.((((..(((...((....((((..............))))....))....)))..))))...)))))))((((.....((((((((.....(((((.((((....(((.(..(((((.(((...)))...))))).).)))....)))).)).))).((((((((((..((((.........))))..((((((......))))))......((((.(((..(((......((((((((.....)))))))).......)))..))).))))........))))))))))((((((((..................))).))))).......((((.((((....))))))))........)))))))).))))............(((((.......)))))..)))))))))))....(((....)))....(((((((....)))))))..((((((.......)))))).....((.((((.......)))).))......)))))))))(((((((............)))))))(((....))).......))))))).).)))))..)))))).)))))).)))))....))))))))))))).(((((((((..................)))).))))).........(((((.((((.((((((((.........)))))))).)))).)..)))).))).)))))))).)))))))))))))))).))))))))).)))))))..(((....((((.....(((..((((((((........)))))))).)))........))))..)))...(((...(((((((((...........((((((...))))))............)))))))))....)))..))))).)))))))))))))..)))))....((((((..((.(((.(((....))).))).))..)))))).....))))))))))..))))))))))))))..))))))(((......))).........((((((((((......))))))))))))))))..)))).))(((((...((.((((.(((.(((.......))).)))))))..))..)))))))))))))...)))))).((.....))))).)))))...)))))).....((((((((((((.((((((.((..(((((.......))).)).)).))....)))).....))))))..)))))).((((((((....))))))))...((((((((((...((((((..((((..(((((((((((.......))).)))))))).......(((((...))))).((((((((((....)))))))))).......))))..)))))).....))))))))))........(((.((((.((......(((..((((((((....((((((..........))))))....))))))))..))).......)).)))).)))....)))))..........
Thermodynamic Ensemble Prediction
,(((((.((.(((,...,))..)).))))}{,((((((((((..((((((({(((((.{.{(((((((((((....)))))))))))).).))))).((((((((((((((.(((((......))))).,,(({{(({,({{{(({,,,,{((({,...|}}}},,}||||......{{{(|,|...((((((....((((...)))).((((((....((((((((.....((((((((((..{(((((......))))}|,,..((((....)))){|||,,{(((..(.(((((.(((((((.(((((.(((((,{(,.|...,,(,((,{,....,,..|||||,,,(((((.(((....))).)))))..,,{||||,|(((,(,,,,|,|}}|.|}}}}}}|{||||{||{{{({(((((({((({.((.(({{{{,{((..{{{,.(((......))).((((((({,..((((((......))))))..(.((((((({{{(((({,,,..{(({((({((((.,,,}}}}}}}.|||{(((((((({.,{{(((((((..((((((((({((((,,,,.........}}}|..|)))}))))}.)))}}}|.(({,,{{{({{....{((({{({{{{,{{{(({{({({({,(({{.,{{{{...{{((,.......((((({{..(,,....,,,,|,,,,,||}}})),,.,,,,..,(((((((((((({.....((((((...(((((......,......{{{....}))..(((({,{{.,|||{((((((.(........).)))))).}|||,,|...))))))..)))))...))))))....))},..})))))))))}.{||||,.}}}}|..(((......}|||||}.||,||||||.}}}|}}},..,{{,..,))})},..((((.(((({...})))).)))).|}||,.}}}.{(({..........||||,,.....}})}}}}}}}|}}}}}}}}}(((((((((..((((((....))))))..)))}..)))))..}}.,)))}))},,))))))},}......}))))))))...}}}},,,,}}}.,)))).})))))).,))))}|((((((((((({{{(((......(((((.((((.,......,.))))))))).((..(((((...)))))..))...(((.(((..((((.....})))..))).)))(((((....))))).{((((((..(((((....(((..((((((((((..((((((|...}))))))..))))....,,{((({,..{{(((.{|{{((({.....,|||}},,{{{((({{((((........)))}..((((....))))........((((.....))}},|},,,|,}}))})))},.,{{{{||,|,..,,}}}}))))},,..((((((.(((((..(((....))).))))).)))))){(((((.{(((((.(((.((..((..((((((,{{{{.,,{,,,.{||{.,,{{,||}.((((..(((((((..((((.(((((((.....(((((.(((.....))).)))))....))))))).))))..)))).))).)))),|,|,||,{..,,,....}))),.)),(((({....})))),,,,,......|||||{(((((....)))))},,.........})))))..))..)).))).))))))})))))|,||||....)))),.}}......))))))..)))..)))))....))))))}..))))))))))))))))||{{{{...,,,,,))))}}}||||((((((((((((....))),})))))))).}}}},(({,||,,,,,,|.|||,.,{{||,|,|||||{,...|,.....,{,.{{{{{{,,......{{((((,{{{{...,,,....,{{{{{{.(|{{..{{{...,|,...||||,,...,,,,.....,)))....,,....}}),,))))...,))))))||||.,,,,|||(({({.,,.,{,{,{{{{((,.{,({{.{..{{(((,({,.,.|||.,.})))},|.|||{{..,,,,}))}))},,{((((((({..{({(...,,,.,.)))),,{||||{......))))}},..,|,||||.{{{..(((....,,{(((((((.....)))))))),.}....)))..))).}}},.,}},...)))))))))}{{{,,{{{.....,,,|.|,|||,,,|,||||||,...,{||((((,{(((,,,,||}}}}}}........}}}}}}},,))}}............(((((.......)))))..}}}}}}}}}}},,}.,,...,}))}.,,.(((((({....)))))))..((((((.......))))))..,}}}|}|||({{{{{{{||||{{,.{{{{.,|||||||{(((((((..,.........)))))))(((....)))...,,.,)))))))})})))),.}}))))}},.,,..,,})))))}.,}}}}},)))}.}}||||||},},}}}}}}}.}}}}},,||||||.,}}||...}}.,{((((..{((.((({.(((((((((((((.,,...(((({{,|{|{,{,{({||,..}}||},}.,||,.}|||.,,||||{|,,,,,|}}|}}},,,}},|||}||,,|,{{{{....,}}||{{{{,,.,{,,...},,,}}}}}))),......}))))).....))))))))))))}.|)))..}}}.))))||((({...})))),....||,...}})},,,))))}}}}}}}..))))).)))))))))))))..)))))))}.((((((..(({({({((,..,})),)))).},..)))))).....))))))))))..)))))))))))))),.)))))).,,.,.}))))..........{(((((((((......))))))))))))),,),,)}}}.,.(((((...({.{{((,(((.(((.......))).)))))}}..)),.)))))))))))))...)))))),((.....))))).)))))...)))))}.....((((((((((((.{{{({{,{{..(((((.......))).))..},}.....)))).,,,.))))))..)))))).((((((((....))))))))...{{{(({,{{({{,((((,{,,(((({.(((((((((((.......))).)))))))))}}))}},|||,}}})),,}.|(((((((({....)))))))))}..,})})||||{.},|||}...,.}},,}))))}{{{{{{..,.({(,,,((({{{...{{,..((((((((...,((((((..........)))))),,..))))))))..},},||....,,,)})),))))))})),},))}}}}....

Transcripts

ID Sequence Length GC content
GUGCGGGGCCGCGCUUCCGCCAGCGCCGCAGCGGGGAAUCUGCAGUAGG… 3508 nt 0.4051
Summary

This gene encodes a protein with both O-glucosyltransferase and O-xylosyltransferase activity which localizes to the lumen of the endoplasmic reticulum. This protein has a carboxy-terminal KTEL motif which is predicted to function as an endoplasmic reticulum retention signal. This gene is an essential regulator of Notch signalling and likely plays a role in cell fate and tissue formation during development. It may also play a role in the pathogenesis of leukemia. Mutations in this gene have been associated with the autosomal dominant genodermatosis Dowling-Degos disease 4. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]

Forensic Context

A study in humans and mice identified POGLUT1 as a key diagnostic mRNA biomarker, with its expression significantly elevated on sepsis day 1 in patients and showing diagnostic potential with an area under the receiver operating characteristic curve of 0.7683 [Fang et al. DOI:10.1007/s10142-025-01714-x].