| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUUGUUCCGCCGGUCGCGCCGGAGCUGGGUUGCUCCUGCUCCCGUCUCC… | 1290 nt | 0.4326 |
The protein encoded by this gene is a DNA polymerase involved in base excision and repair, also called gap-filling DNA synthesis. The encoded protein, acting as a monomer, is normally found in the cytoplasm, but it translocates to the nucleus upon DNA damage. Several transcript variants of this gene exist, but the full-length nature of only one has been described to date. [provided by RefSeq, Sep 2011]
A study in humans using post-mortem tissue RNA sequencing demonstrated that the POLB gene, involved in DNA repair, was downregulated as part of the inhibited base excision repair pathway specifically in the lungs of sepsis patients compared to uninfected controls [Pinheiro da Silva et al. DOI:10.1111/jcmm.17938].