Basic Information

Symbol
POLR2A
RNA class
mRNA
Alias
RNA Polymerase II Subunit A RNA Polymerase II Subunit B1 POLRA POLR2 RPB1 DNA-Directed RNA Polymerase II Largest Subunit, RNA Polymerase II 220 Kd Subunit Polymerase (RNA) II (DNA Directed) Polypeptide A, 220kDa DNA-Directed RNA Polymerase III Largest Subunit DNA-Directed RNA Polymerase II Subunit RPB1 RNA-Directed RNA Polymerase II Subunit RPB1 DNA-Directed RNA Polymerase II Subunit A 3'-5' Exoribonuclease EC 2.7.7.6 Polymerase (RNA) II Subunit A EC 3.1.13.- EC 2.7.7.48 HRPB220 NEDHIB RpIILS HsRPB1 RPBh1 RPOL2 RPO2
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses Other applications

MANE select

Transcript ID
NM_000937.5
Sequence length
6749.0 nt
GC content
0.5613

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-2318.80 kcal/mol
Thermodynamic ensemble
Free energy: -2433.79 kcal/mol
Frequency: 0.0000
Diversity: 1834.84
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..((((((((((((.((((((((((((((.(((.((((..(((((.(((..(((((((((((((((.....))...((((((....((.....)).....)))))).............................))))))).......(((((...(((((...................)))))..)))))..))))))...((((((.((((((.......)).)))).)))))).))).))))).))))...))).)))).....((((......((((((......))))))......)))).))))))...((((.((.(((.((.....(((((((((((((((((((((.......)))))))))))).((((...))))..)))))))))......(((((((((.((((...((((((..(.(((.((((((((((((((.(((.....(((((((((...((((((.((((((.....(((((((....((.(((((....(((((((.((.....(((((......))).)))).)))))))...(((.(((((((((.(((...((((.(((((((((...(((.((..(((((.((((((....)).))))(((((((((((...))))..(((....(((((((........)))))))))).))))))).(((((((.....(((((((((.......))))).))))(((.(((((((((..((........))((((........))))...........(((....)))((((..((((...)))))))).)))))))))..)))....)))))))(((((((((.(........)...)))))))))(((((((....((((.....))))(((........)))...((((((..(((.(((......))).........(((.(((((((((((((((((((((.(.(((((((.((((.(((((((.(((((((.(..((((..((((.....(..((((((.(((((........)))))..))))))..)....))))....(((((((((((((.((((....)))).)))))....((.((((.....)))).))...((((((..(((((((..(.....(((((......))))))..)))))))))))))((((.....(((((((((.((((...)))))))..((((....))))..))))))...)))).......))))))))........((((((.((............)).))))))((((((((..((((..(((((.((...)))))))))))..)))).)))).(((.(((((........))))))))......)))).))))))))...)))))))(.(((.((((..(((((...))).)))))).))))..)))).))))))).)..)))...))).(((((....((((((..(((((((((((((..((((((.......((.(((((((.((....))..))))))).))((((((.....((((((((((((((((((..(.((((((.((...........((((.(((((((((.(((.........(((((((....(((((((.....((((((.....((((((........))))))(((((((.....(((..(((((((...((((((((((...))).)))......))))....)))))))..)))...)))))))(((((........)))))....))).)))...((((((((..((((((((((.......((((.(((.((((((((.((.(.((((((..((((........))))........((((.(((........)))))))(((.((((((..((((.....(((((.(((((((..........)))))))..((((((((....)))))))).((.((((((((........)).))))))))((.((.(((...(((((((.................))))))).....))).)).))..((((((......(((((((..(((((((.......((((((((((((.(((((((((......))))))).(((((.............)))))....)).))))))..))))..)).......)))))))...(((..(((.....)))..))).............))))))).....)))))).))))).....))))..)))))))))(((.....)))))))))).)))))))))).))).))))))))))))))..))))).))).(((((.(((((((((.((((..(((((((.((.((((((.......))))))))...........(((((((((..((((((....(((.((.((((........((((..((((...))))(((.((..(((((((.(((.....))).)))))))..)).)))...)))))))).)).))).............((...)).))).)))..)))))....))))..(((.(((........).))..)))....)))))))........)))).)))))((((((((..((....))..))))))))....)))))))))...))))))))))))))(((((........))))).........))).))))))...)))))))..((((((...)))))).......)))))))))))))))).......))))).)))))).....)).))))..(((((.(((.....(((...)))...))).)))))..............)))))))))))))).))))).((((((...(((((((((((......((..((.......))..))))))))....)))))))))))(((((..((..((((.....(((((....)))))((((((..(((..(((((.....((((....)))).....))))).(((((...((.(((((..((.(..(((....((((((....(((((.....))))).....))))))....)))..)))((.((((.((((((((((((..((..((((...))))))))))).(((((((.....))))))).(((...(((((...)))))..)))(((....((((((..(((((((......))))))).((((.(((((((((((((((........))))..........((((((((.(((((.....(((.(((.((((((((.(((((.((((((..((((............((((((.(((..((..........(((((....((((.(((((.((.((..(((((((......((((...............((((((((.(((................)))))))))))....)))))))))))...(((((((((((((((.(((((.((.....((..(((....)))..)).....(((((.((.((....((((....(((...)))....)))).......)).)).)))))(((((((((.((((..(((((((((((.......))).((((((((((..(((((...((((.......((......)).....(((((...((((((((((((((.((.(((((((...)))....)))))).))))).).)).((((((.(((..........((((.(((((...((((.(((..((((((((.((.((.......)).))....(((((......((((((..(((....))).)))).)).......)))))(((.(((..(((.(((((((.(.((((((...(((......((((..(((((.(........((((.((.(((((.(((......))).))))).)).)))).......))))))))))(((((((((..(((....(((((((((((..(((...............)))...((.((((..(((........((((..(..(.((((((((((((..(((.(((....).))..)))...((((......)))).....((((..(((((((....)))))))(((((((..(((...((((((......)))).))..((.(((.(((((((((..(...(((.((((.........)))).)))...)..)))..(((((((.(((((((.(((..((..((.(((((((((((((.((..((((.((((((((.......((.(((........))))))))).))))))))..))(((((.(((....))))))))...................))))).))))))))..((((..(((((((...(((..((.(((((.....))))).))..((.(((.((((..(((..((((((((((.(.((((.((((((((..(......)..)))))))).....(((((((((....)))))))))..((((.((((.(((.((.((..((((((((((.(((((.((.(((..((((((......)))))).....((((.......))))....(((((((((((((.........(((((((((((((.....)))))).....))))).)).(((.((((......((.((((.((((.....)))).)))).))......)))).))).(((((....)))))....))))))).))))))((((((......))))))..(((.....))).((((((((.((((((((.((((((((((((.(((((..((.((((((.....)))).)).))..)))))(((((.(((((.(((((((.........))..)))))((((((((.....)))))).)).....(((((..((((((......)))))))))))))))))))))((.(((((((....)))))))))......(((...)))(((.(((.((((.....((((.((......))))))))))..)))))).......))))))))).))).)).))))))))).)))))...))))))))))))(((((((.......)))))))...)))))))))))))))...))))))))...(((((((.....))).)))).....))))))))).)))))))))..)))))))))...((((...))))..((((((........))))))....)))...)))))))..))))..))..))..))).)))))))))).))))...........(((....)))...............)))))).)))))))))))))))))))................)))))).).))))).)..)..))))....))).)))).)).....((.....))...........(((((...............)))))..))))))).))))))).))))).))))......)))..))).))).).).))))))..))).))).))).....))))))))........)))))))..)))..)).)))).........))).))))))))))))))))).))))))))).....))))))))))..))).))))).)))).)))))..))))....)).))))).))))).......)))).))))))....)).)))))).).))))...........((((....))))...................)))))..........))..)))..)))))).....))))))).))).))))))))).))..))...))).)))....)))..((.((........)).))..............((((.....))))...)).))))))))....((....))............................)))))))....(((....))).....((((((.................))))))....))))))))..............))))))....)))))))))).)))).))............)))))...))....)))))..........................)))..))))))...)))).))..))))).((((......))))....))))))....)))))..........)))).)))))).)))))))))))..)))))).)))))))....))).))..)).)))...)))..))))))....)))).))).))))))).))...))).))))).))...))).)))).))))))..))).))).....)))))..))))...)))))))).))))))))).(((((.((.((((((........)))))).))..)))))))))))))))..)))).))))))))).)).))))).)))).........((((....))))..)))).)))))..)))))))..............((((.((...((.(((((((((.........((.(((((((((((...)))))).))))).))..(((((((....((((..((((((((((((....((((...))))(..(((...)))..).)).))))))))))..))))...........))))))).....(((((((....))))))).........)).))))))).))...)))))).........((.(((((((((...........)))))))))..))...............
Thermodynamic Ensemble Prediction
..{(((((((((((.((((((((((((((.(((.((((..(((((.(((..(((((((((((((,({......,..((((((....{{.....)).....))))))..........,..,.............,,))))))).......,{{{{...,{{{{....,,,,..,,,,,....)))))..)))))..))))))...((((((.{(((((.......)).)))}.)))))).))).))))).))))...))).)))).....((((......((((((......))))))......)))).))))))..,((((,((.(((.((.....(((((((((((((((((((((.......)))))))))))).((((...))))..)))))))))......(((((((((,((((...((((({,,((,(,.((((((((((((((.,,,.{.{,(((((((((,,,(({{{(.(({{((.,,,.{{{,{({....((,{{{{{,{{,(((((((.,,.....((({(,,....))}.))}|,|}}}}}}...|,,.(((((((((.(((...(((({(,(((((,(,.{(,({((..(((({.{{{{||....||.}|||{{.{(,,{,,,..})})),}|||||..{{(((({........))))))}|||,{{{,..}}}{{(((({....(((({{{((...,...|||||{|||{((({(((((((((..((........}},{{{{{......,,,..,,........(((....)))((({..((((...)))))))).}))))))))...))))}.)},,..,{(((({{{{,|,|,,....}...}}}||||}|((((((({{{{({,,.....|||}((,{{{{....,,,...((((((..(((.,{(..,,..,},...||,.,.(((.((((((((((((((({{{{{{,(,(((((((.{{{{,{{{{{{{,({{{{((,(,.,{((..((((.,,..,..((((((.(((((........)))))..))))))..},,|,|||}.,{.(({{{{(((((((.((((....)))).)))))}...((.((((.....)))).))..,((({((,,(({((((..,,..(.(((((.,....}|||}|,.}}||}}}}}}})|{(({.{{,,(((((({{(.((((...))))}},..((((....))))..}}}}},...}}}}.......}))}})))..,,,.},||{||{,{||...,,,,.,..}),))))))((((((((..((((..(((((.{,...}})))))))))..)))).)))).,||,{||||,|,,,.,,||}}}}))|}}}}.)}))}))}}))))...}))|||},.{{{,(({{..({(((...))).)))))}.)))|..|}}},})}||||,}..|||,..|||.(((({...,((((((,,{((((((((((((..((((((.,,,.,,{(.(((((((.,,....)}..})))))).||(((({(,....{{(((((({{{((((((,.,{.(((({{((((.,,,..........||||||.|||},,,.{{{.(.((((..(((..,,.....||.)))..))))}.}}}.((((((........))))))(((((((.,...(((..(((((((...((((((((((...)))},))......))))....)))))))..))),..)))))))|||||}}.,|||{||||,,...||}||}|...((((((((..((((((((((.......((((.(((.(((((({{{((.(.(((((({{((({,,......}},)}}}...,,((((.(((........)))))))(((.((((((..((((.....(((((.(((((((..........)))))))..((((((({....}))))))).((.{(((((((........},})))))}))((.((.((({.,(((((((.............,...))))))}...,.))).)).))..((((((.|.,..(((((((..(((((((.......((((({((((((.((({((({({{{,..})))))}.(((((.,........,..)))))},}})).))))))..}))}..)).......)))))))...,((..(((.....)))..))}.............)))))))...,.)))))).))))).....))))..))))))}}},{(,....)))))))))).)))))))))).))).))))))))))))))..)))))}})},{,{(({((((((({{||,,((((,{{(((.((.((((((.......)))))))),}|.|......(((((((((..((((((....,{{.({.((((........{(((,.((((...))))(((.((..(((((((.(((,...,))).)))))))..)).)))...}}}})}}}.}}.}},..,......,..,||...}}.))).)))..))))),...}))).{((({........{{{{{,(({{{{..,,.{{{||....}|||}.((((..(({{(((((((..((....))..)))))))))).))))}})),.....}})))))).,,))}}|,,......}})))||.........,}}.,)))},.,})}))))})}||||||...)))))),|||,.,}})))))))))))))},,,,,,,}}}}),)))))}...},)).)))}..(((((.(((.....(((...)))...))).)))))....,,,....,,})))))))))))))).))))|(((((((,..(((((({{,{|,.,}..||,,|{,.,,...})}.}}}}))}},,..})))}))))))}(((({.(({|(((({{{{{((((,,{{{|||||{(,((((((.,.(((((....})))))}}}})))}},..})}),..|{{|}}}|||,,(((({{((,{..,{,,,,,||(((((((({,.(({,{{.,(((((({..,.))))}}){||,.....,|}|(((.((((..((((((..,{..((((...))))),))))))..)))}.}},...,))},.}}}}...},}))))))).,|,...........((((((,.(((((((......))))))).((({,(({,(((((((((((,,......))))..........{(((((((.(((((,,..,(((.{((({{((((((.({((((({,(({..((({..,.,.|,....((({((,(((..((,.........{{{{,.,,,{{{{.((,((((,(((,.,,,{|{{,....,}}}},.,,,,.}},..,|,{(((((((.,((.|{...........}}))))))))))},..,}}..}}}}||,.,.((((((((((((({,.(((((.{(,{.......|||,,..|{{...{{,...{{||,.{{,{{.,..,........,,,|||||...|}}.}}}},,,.))}}}.|||.{(({,(((((,((((..(((((((((((.......))).((((((((((..(((((...((({.......((....,.}}.....(((((...((((((((((((((.((.(((((((...)))....)))))).))))).).)).((((((.(((.......,..((((.(({{(...((((.({(,.((((((((.((.((.......)).))....(((((......((((((..(((....))).)))).)).......)))))(((.(((..(((.((((((,,(.((((((...(((......((((..(((((.(........((({.((.(((((.(((......))).))))).)).,))).......,)))))))))(((((((((..(((....(((((((((((..(((......,,...{..,|}}...((.((((..(((........((((..(..(.((((((((((((.{(((.{({...,|.}|,.}}||..((((......)))).{{,,{{{{...{||||,..{,||||},,(((((((..,{{...((((((.,....}})).,},|||.({(.(((((({({,.,...{({.((((.{.......}})).)}}.,.)},))}..(((((({{(((((((.(((..,,..{(((((((((,(((((.((..((((.((((((((....{{(,(.((,....,...},))))))).))))))))..},(((((((((....))))))))................)))))}.)))))))))..(((((..(((((((...(((..((.(((((.....))))).))..((.(((,((((..(((..((((((((((.(.((((.((((((((..,......}..))))))))...,.(((((((((....))))))))),.((((.((((.(((.((.((..((((((((((.(((((.{{.(((..((((((......)))))).....((((.......))))...,(((((((((((((......,,,(((((((((((((.....)))))).....))))).)).|||,{(((,,....((.((((.((((.....)))).)))).)).,,...)))),|}|.(((((....))))),,,.))))))).)))))}((((((......))))))..{((.....))}.((((((((.((((((((.((((((((((((.{((((..((.((((((.....)))).)).))..))))|(((((.(((((.{{(((((.........||.,||||}|,((((((,,,..}}}}}}.,......|||||,,||||||,.....)))))))}}}}))))))))))|{.(((((((....)))))))},......(((...)))(((.(((.((((.....((((.((......))))))))))..)))))).......))))))))).))).)).)))))))))}}))))...))),,))))))){||{||{.......)))))))...)))))))))))}))}...))))))))...(((((((.....))).)))).....))))))))).)))))))))..)))))))))...((((...))))..((((((........)))))).,.,)))...)))))))..}}}}..))}}),..))).)))))))))).))))...........{{{....,},...,,..........)))))).}))}},,.)))))))}))),.....,,}}....,.)))))).,,))))).)..}..)))),,..))).)))).})...,}||...,}),}},}.,.....|||||.,}},,,,.,,,...}})}}|.}))))}}.}}}}})).))))).)}})...},,))}..))).))).},).))))))..))).))).))).....))))))))...,,...))}))))..}}),.)).)))).........))).))))))))))))))))).})))))))).....})))))))))..))).))))).)))).))))).}))))},..,..,},,,.,,,},..,,,.,))))}}})))).,.,}..}..,,}.,,,})}|..........((((....))))..........,},......,,,}}..........}}..))}..}})))}..,,.}}}})))..}},)}))))))).))..)),.}))},,})}},,}}}..{{.,,........)).},..............((((.....))))...)).))))))))....||,...)).....,,.......},............)))))))...}})))}..||||....||||.........}}}}}}....)))})),,....,})))},......,,,,,,,)}}))),...))))}))))),}}))}))).}}}..})}))),))))}}}.....,,,......}}}}}}}.......,}}}},.})}),,}},}}}...,}},..,...,},,.,|||.}},}},.},,)}})))).,..}))),)).,})))))..)),)})),))).))))))),)),..},))}}.)))))},,..,}))}},.,),,))),,.}}}..}},)))},..}))}.|||{,,|||||,||,...||{||}|,.}|{.{|||.,,))})})),}..,,).))).,...)}}})).))))..}))))))))}}))))))))..|,||.,,{((((,{.,}}}},.|||||}.})||)},},})},))))}}..)))).))))))))).)).)))}),))))}........((((....))))..)))).)))))..)))))))...........,,.((((.((...((.(((((((((....,.,..((.(((((((((((...)))))).))))).))..(((((((....((((..((((((((((({....((((...)))){..(((...)))..).}).))))))))))..))))...........))))))).....(((((((....))))))).},.....,))}})))))).))...)))))).,{{,(({.{{{({({,((((,.,{,,.....})),))))}..,.,}}}...))}.}},.

Transcripts

ID Sequence Length GC content
GCUCAGAAGCGCCGAGAGCGCGGCCGGGACGGUUGGAGAAGAAGGCGGC… 6749 nt 0.5613
Summary

This gene encodes the largest subunit of RNA polymerase II, the polymerase responsible for synthesizing messenger RNA in eukaryotes. The product of this gene contains a carboxy terminal domain composed of heptapeptide repeats that are essential for polymerase activity. These repeats contain serine and threonine residues that are phosphorylated in actively transcribing RNA polymerase. In addition, this subunit, in combination with several other polymerase subunits, forms the DNA binding domain of the polymerase, a groove in which the DNA template is transcribed into RNA. [provided by RefSeq, Jul 2008]

Forensic Context

A study in human forensic autopsy cases demonstrated that POLR2A serves as a validated and highly stable reference gene for mRNA normalization in postmortem brain tissue analysis [Wang et al. DOI:10.1007/S00414-013-0868-X]. In a separate human study investigating methamphetamine intoxication, POLR2A was similarly employed as part of a validated reference gene set for RT-qPCR analysis, enabling the detection of significant mRNA expression changes in biomarkers associated with blood-brain barrier permeability [Wang et al. DOI:10.1007/S00414-014-0972-6].