Basic Information

Symbol
POSTN
RNA class
mRNA
Alias
Periostin OSF-2 PN Periostin, Osteoblast Specific Factor OSF2 Osteoblast Specific Factor 2 (Fasciclin I-Like) Periodontal Ligament-Specific Periostin Osteoblast Specific Factor 2 Osteoblast-Specific Factor 2 PDLPOSTN
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis

MANE select

Transcript ID
NM_006475.3
Sequence length
3301.0 nt
GC content
0.3878

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-812.80 kcal/mol
Thermodynamic ensemble
Free energy: -881.14 kcal/mol
Frequency: 0.0000
Diversity: 1007.32
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
........(((((((((.......((((.(((((((...((.(((..............))).)).))))).)).))))..(((.(((((............(((((..(((..........))).)))))((.((((.((((......((((((((...(((((((.((((((........)))))))))))))...............(((((...((((....((.(((((......((((((.((((((((...((((((.......(((((....(((((((((((((....((.((((((((((((((((((...))))))))(((((.((.((((....))))))...)))))...((((......))))........((((((((....(((((....)))))....)))..((((((......)))))).......(((..((((((......))))))..)))...((((......))))((((((((((((((..((((......))))..)).)))))).))))))..((((.(.((.((((((......)))))).)).)))))......)))))....)))))))))).)))))))))....))))))..)))))...((((((...))))))))))))..)))))(((((.((((......((((((((.((((((((((((((.....)))))).((..(((((.(((((((....))))....((((((.(((....((((((((...(((((.((((.(((((..((.(((((..(((..(((.(((...............))).))).))).))))))).)))))))))...(.(((((((((((....(((..(((((..((.(((((...))))).))...)))))..))))))))).))))).)))))).)))).)))).))).))))))............(((((((.((..((.(((......(((((..((((.((((((((.(((((((((....................((((.((((.(((((((((.((...((((((((((.(((...(((.......((((((.....)))))).)))...))))))))))(((((((........)))))))...))).))..)))))...))))((((.....))))....)))).))))..(((((((((((......))))((((.((......)).)))).((((((......((((((((((...(((((((..((((((((((..((.(((((((.((........))((((((........((((....))))............(((((.(((.(......).))))))))..(((.......))).........))))))..((((((..((...........))....)))))).(((((.((....)))))))........)))))))..))..)))))....))))))))))))........((.....))..))))))))))......))))))...........)))))))..((......)).))))))..))).).)))))))))))...(((....))))))))))).))))))))))).((((((.....))).))).(((((((.(((....(((((((((....((((((........(((((...))))).........)))))).....)))))))))....((((....)))))))..)))))))..((((((((...(((.((((...................)))).))).....)))))))).....((((((.........))))))))).)))))..))..........))))))(((((((........)))))))..((((.(((((......(((..(((.((((((((......))))))))..((((((.(((((.(((..(((((((.....................)))))))...)))..)))))(((((((((............((((((((.(((((((..............)))))))........(((((...)))))..))))))))(((((.............))))).(((..............)))....)))))))))...(((....)))..)))))).))).)))......)))))))))))..)))))))))))))))))....................))).))))))))))).))....))))))))).....((..((.......))..))......))))))))......)))))))).))((((((((...))))))))))))))))...)))))))))..(((((((((((((((((..(((...((((((..(((...)))..)))))))))((((((......))))))...........((((.(((((.((........)).))))).)))).............(((((((..((((((.((.(((((((.......))))))).)))).....))))................(((....)))..((((((((.......(((..(((((((((.(((...((...(((((.(((((...)))))...)))))...((((((((.....((((((.((((((..(((((.((((((((((((((............(((.((((..((((....))))..)))).)))............))))))))))).(((((...((((..((((.(((((((((.......((((..((((...(((...))))))))))).......)))))..))))....((((((((........))))))))(((((((.((((((.((..(((......(((((.(((((.(((((....))))).))))).)))))......))).)).)))))))))..))))...))))..))))...))))).((((.((((((.....)))))).)))).((((.....(((.((((....)))).)))....)))).............))).)))))....)))))))))))).....))))))))))....))))))))))))..)))............(((((((((((............(((((((((......))))))))).....((((.........)))).))))))))))).))))))))....)))))))..)))))))))..))))))))....(((((.((.....)).)))))..
Thermodynamic Ensemble Prediction
.,,{(,((((((((..(.{.....})..))))))))}|...,,{(((({{((((,,.,,,.{{{(((((({,{{..,{(,{{,,,,{{{{{,{{{{{,....(((((..,((.....,,,,.}}}.|}|||,({{{{{{{{,{,.{|||{,||||||..,(((((((.((((((........)))))))))))))............,,,||{{{..,{.,,.,,..}}}}}}|.....(((((....})))).,...,}}}}}}}||||.{{{({.,..((((({(((((((,...,,.((((((((({,{((((((...))))))}|(((((.{(.((({....))))))...)))))}..((((......))))...|||,,{{{,,{{{,..,(((((....)))))||||}},.,{{{{||..,,,.)))))).,,,...{((..((((((......))))))..))}...((((......))))((((((((((((,{,.(((({....,))))..}}.)))))}.))))))..((((.(.((.((((({......)))))).)).})))}......,}})),|,.}))))))))).,}}))))))....})))))..})))},,,|{{{{,...}}))))|||||,{{,{{,((((((,((((......((((((({.{{(({{((({{{({..,,.)}}}}}.{{,,(((((.{{{((((,...,)))....((((((.(((....((((((((...(((((.((((.(((((..((.((((({{({(..(((.(((...............))).))).})))))))))).))))))))).,,(.{((((((((((....(((..(((((.,({.(((((...))))).}},,.)))))..))))))))).))))),)))))).)))).)))).))).))))))..,,........(((((((((((,.({({({.,,..,,{{{..((((.(((((((|.((|({{{((.............{|{{|||((((.((((.{{{{{{{{{,,|...{{{((((({{{(((...(((.......{{((|{....,)))}),.)))...))))))))))(((((((........))))))}...}}}..,..}}}}),,.))))((((.....))))....)))).)))),.|||}|||{(((......)))|((((.((......)).)))).((((((......((((((((((...{((((({..{{{{{{{{{(,,((,({(((((.((.,,,,,,.||((((((........{(({....}},|.......}},..{{,,,{(((.(,,....}.}}}}})}}..,||,,.....}}|{...,,...))))))..((((((..{,......,....,},.,,)))))).{(((,{({....))))))}.|,,....})))))}..}}..)))}}....})))}))))))}....,...||},,,,))..))))))))))......)))))).....,,,,..,},.,,,..{{,,,,}})).}})))}.,})).,.)))))))))))...|||||,|||||||{.}},,,...}}))))}.|{{.((({{{{.||.,,,}},|}}}}}}||,,,,||(((((((....((((((........{((({...}}))).........)))))).....)))))))}}.,,,{((({(((((((,,|.{{{|||,}..,|,|,,,|,..}}}}||||},.............,...,,,}.{((({{.....,))))))...((((((.........))))))))),)})))..|}....,.....}||}}}(((((((........))))))).,||||,|{||{,{,......,.|||.((((((((......))))))))..,|,,,..{{{{{{((...{,{{{{{................,,,..|||}|||{{{|||{.|||,,(((((((({...........{(((((({{.{{{{(((..............})))))},..,,.....,,...,||||},.||||,}}|,,{,|}}}...,},,...})}}}}},,,,,},|,......})}},...})))))))).}))}}}}..)))}}))))}...)}}))))...,.,,,,})}}}}}..|}}}))))}))))}}}}|.,.......,..||.....,,}})))))}}}}}}||||},.....,|,.....,,,.,}}}.,,,,...},,)),}}..,}||||||............,|}})}}||{|{||}}.))))))),..((((......))))..{...(((((((((((((((((.,(({..{((((((..(((...)))..)))))))))|{{{((..,,,.||}}},.,,.,,,,,,.(({{.(((((,((.,.....|)).))))}.||||{,,,,,{,,,...,,,{{{{..((((((.({.((((({{.......}}}}}||{||||,{...,|||,.....,,,,,.....{(({{.,{{{,.,((((((((......||},||||}....|}|)},},}}...{(((|,((({|,..||||}...))))}...,{((({{{.....(({{{,,((((({.,{{({,,{{....,,,.{(((((,....}}}}}|{|,{{|{,}||||}}|,{{||{{{{||,|||,,.,,|||,..{(({({{..........|,,.,,.|.}}}|}}}|{{{{{|,.....,,||,,))}}}}}))||||,,|}}}},}|}|}....,,})}}},.|}}}}}}.{((((((((........)))))))))|||{{{.((((((.((..(((..,.(.(((((.(((((.(((((....))))).))))).))))).,....))).)).))))))}}|..||||,,.,,,|..,||}|,,}}|||,|{{,.{|||||,,,..}},}))}))))})}}})))}.}}}}|||},}}}},,},||{{{..,,,,.....,,}}}|,.,,},|}}}}....)))))))))))).....}))))))}},...))},,}}}))}}}|,}}|,..|||||,...{((((((((((..,,,.,,,,..(((((((((......)))))))))......,{|,....,}},,))).}))))))))))}}}||||}}..,,)),))},..)))))))))..))))))))...,}|,...,})}..,}},..,,...

Transcripts

ID Sequence Length GC content
GCCAGUUCUCUUCGGGGACUAACUGCAACGGAGAGACUCAAGAUGAUUC… 3301 nt 0.3878
Showing 11 to 11 of 11 entries
Summary

This gene encodes a secreted extracellular matrix protein that functions in tissue development and regeneration, including wound healing, and ventricular remodeling following myocardial infarction. The encoded protein binds to integrins to support adhesion and migration of epithelial cells. This protein plays a role in cancer stem cell maintenance and metastasis. Mice lacking this gene exhibit cardiac valve disease, and skeletal and dental defects. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]

Forensic Context

A study in human myocardial infarction tissue identified POSTN as a characteristic marker for endocardial endothelial cells, validated by single-molecule fluorescence in situ hybridization [Kuppe et al. DOI:10.1038/s41586-022-05060-x]. A study in rats demonstrated that the POSTN (POSTN) was upregulated 4.5-fold in right ventricular tissue during monocrotaline-induced pulmonary arterial hypertension and failure, where it was identified as the most up-regulated gene and a matricellular protein relevant to fibrosis [Potus et al. DOI:10.3390/ijms19092730]. A review of single-cell sequencing in mouse models of myocardial infarction further identified the POSTN as a specific gene marker expressed in myofibroblast clusters, which are central to cardiac remodeling and fibrotic processes following injury [Bian et al. DOI:10.3892/mmr.2025.13680].