Basic Information

Symbol
POU2AF1
RNA class
mRNA
Alias
POU Class 2 Homeobox Associating Factor 1 OCA-B OBF1 BOB1 OCT-Binding Factor 1 POU Domain Class 2-Associating Factor 1 B-Cell-Specific Coactivator OBF-1 POU Class 2 Associating Factor 1 BOB-1 POU Domain Class 2, Associating Factor 1 OBF-1 OCAB
Location (GRCh38)
Forensic tag(s)
Postmortem interval inference Wound age identification

MANE select

Transcript ID
NM_006235.3
Sequence length
2875.0 nt
GC content
0.5339

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1016.63 kcal/mol
Thermodynamic ensemble
Free energy: -1066.16 kcal/mol
Frequency: 0.0000
Diversity: 704.61
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..((((((((((.(((((.((........)))))))...........((((((........))))))...((((...((((......))))...(((..((((((((...............)))))))).)))......((((((.(((((..((.((((((((....(((((((((((.(((((((.....((((((((((.((((....(((((..(((((((((((((.((..(....)..)))))))))))))))......)))))(((((((......))))))).....(((..(((((((((....))))))))))))((((((.(((.((((((...(((.(((((..((((.....))))....))))))))...)))))))))(((..(((((.(((..(((.....))).)))..)))))..)))((((((((........)))))))).(((....)))....((((((....)).))))(((((.(((((.....(((....))).....))))).)))))............))))))((.((((((((((((..((((.((((.((((((.....((((((...((((((((((((((((((((((((.......((.((..((((((((((((.(((......((((......((((((.........(((....)))....((((((........))))))....(((((((((((((((..(((((((....)))).)))......(((((((......(((((.(((((...))))).)))))))))))).((((.((((((((.(((((((...((((..(((((.......))))).))))...))))))).))).........))))).))))......)))))))......((((((((((.........))))))))))....((((((((((((((((((....(((((..(((((.((...))))))).))))).....................((..(((((((((((((.((((((((((((((......................((((((.((((...((......(((.((..(((((((((..(((((..((((((.((((..((((..(((..(((((.((((..((((......((((((.....(((((.((..(((..((((((...(((((........(((((((((........................................................)))))))))....))))).....((((((((((...))))....)))))).....((((((.....(((((....((((((((...(((((.....))))).((((((.........)).)))).((((......))))((((((.((((..((((.........))).)..))))))))))))))))))....))))).((((((.....((((.....)))).(((((((.....(((....))).))))))).)))))).....))))))..(((((((...(((((((....((((((((((((((((...((.......)).))))))...)))).)))))).))))))).))))))))))))).))).)).)))))))))))......)))))))).))))).)))..)).)).)))).))))))..))))))))).)))))..)).)).)......))..)))).))))))...)))))))))..))))......).))))))).))))))..)))))))))))..)))))))))...((((((................))))))....((((...))))..))))))))...)))))).......))))....)))...))))))..))))))..))..)).))))).)))).)))))))))..))....)))).....)))))))))))))))).))))..))))))..((((((((((((((((((..((((((.......)))))))))))))))).........))))))))................................................................))))))))...............)))).))))))).))).....)))))))..)))))))))))..))))(((((...)))))...)))).))..((((.(((..((((((............))))))..))))))).........((((..((((.(((((....(((((......)))))...)))))(((((....)))))((.(((((...........)))))..))..))))..)))).....))))).)))))))))).........((((((((((((........(((((((...))).)))))))))))))).))))))))))))..((((..(((((....((((((.......(((((..(.(((((((..(((((((((.....(((((............)))))((.((((..(((.((((((.((((((((((........)))))...(((....)))............((((((......))))))...))))).))))))...))).)))).)).)))).))))).(((((((((((((..((((...((((.(..(((.....)))..).))))..)))).....))))))))))).))....(((........)))((((((.......))))))..(((((.(((((.....))))).))))).))).)))).)..))))).........))))))......)))))...)))).....
Thermodynamic Ensemble Prediction
..((((((((((.(((((.((........))))))}...........((((((........)))))){((((((...(({{....,,||}|...(((..((((((((............,..}})))))}.}}}...||.,,|||,,||,,...}),))))},.,,,|.(((((((..((.(((((((.....((((((((((.((((....((((({.(((((((((((((.,(.{(....).})})))))))))))))..}}..}))))(((((((......)))))))..{{{.,...|||.,.((((((,{{{.{{((.,..((((({,(((.((((((...(((.(((((.,((((.....))))....))))))))...))))))))}(((,,(((((.(((..(((.....))).))).,)}}}}..||{((((((((........))))))))}.||..,.}|,.,{(((((((....)).)))))|{{|||||||,...,||,{{{.|||.....||},,.,,))}..,,,.,,,...)))))))))}}))}{((((((..((((.((((.((((({....,((((((,..((((((((((((((((((((((({.......{,{((..,{|||{{{{{{{.{{{..{{{{,((,..,,,{((((((.,,{,{{..(({{{{((......)))))))..||.,.|..{{{{...(((((((((((((((..(((((((....)))).)))......(((((((......(((((.(((((...))))).)))))))))))).((((.((((((((.(((((((.,.((((..(((((.......))))).))))...))))))).))).........))))).))))......)))))))......((((((((((.........))))))))))....((((((((((((((((,{,.,.(((((..(((((.((...))))))).))))).,.,,........,....,((((,,(((((((((((((,.(((((((((((((.,.,,,,..,............{{{{{{.({{{...,,......,{{.{(,,,((((((((,{{{{((,,(((((({{{((.,({((..(((..(((((.((({,{((,,...,,.(((((,,(((((((((,,({{(((.,({{{{{...{({{{.,{{{...(((((((((........................................................)))))))))....))))).....((({{((((({,..,,,.,}})))))).,|{.((((((.....(((((.,,.((((((((...{((((.....))))}.(((({,.,.......)).)))}.((({......}}})((((((.((((..{(((.........))).)..)))))))))))))))))),,..))))).{{{(((.....{(({,,...}|||,(((((((,{...{{{....})).))))))).))))}).....)))))).,|||,,,....{((((,((((.((((((((((((((((...({....,,.,..))))))...)))).)))))).)))).))))))))).)))))).))).)).))))))))))),,....,))))))).))))).)))..)).)).)))).)))))).,))))))))).))))}..)).|}.,......}),,)))).)))))).}.)))))))))..))))...},.}.))))))),))))))..)))))))))))..)))))))))..{(((((({({.........})),)))))},}..((((...))))..))))))))...,))))}.,.....)))).,,,,))}..))),)).})))}}),.)}..},.)))))},))).)))))))))..))....)))).....)))))))))))))))).))))..)))))),.((((((((((((((((((..{(((((.{....,)))))))))))))))).........))))))))............................,...,..,,..,,...,..,,,,,,,,})))}))))))}},}...}}}}}}}}}..,,,,,,,,...,...}))))}}....,........|||||..,,||||,,((((,.,,|||}}...({.{{{||,((((.(((..((((((............})))))..)))))))..,|,,,.,|}}}..}}}}.}))))})),(((({......)))))...((((.{..,{..((((.(((((((((((.,,{,{,{,....|}}|}|||,{{|,...,))..)))))))))))))))..},..,.)))){(((((((((((........(((((((...))).)))))))))))))).))))))))))))..((((..(((({....((((((.......(((((..,.{((((((..,,,{((((,.....||||,.....,|....{||||,(({((((..{{(,(,,,,|}||((,(((((........))))).},{({....))}............}}}})))))))))..,|...,}))}}.}|||||{{{|}|{{||{{||{||||.|||||({((((((,,(((...,,,|,}.||||}}.,|}},....,))}})}))))}))),,....}}},|||||}|},.|{,...||.,}}}}},}..((((((.......))))))..(((((.(((((.....))))).))))).)}).)))).}..))))).........))))))......}))))...)))).....

Transcripts

ID Sequence Length GC content
AAGCGGUGGCUCCACUGGAGGAAAACACACCCCGGUCUCACAUUAAAGA… 2875 nt 0.5339
Summary

Enables transcription coactivator activity. Involved in positive regulation of transcription by RNA polymerase II. Part of RNA polymerase II transcription regulator complex. [provided by Alliance of Genome Resources, Jul 2025] CIViC Summary for POU2AF1 Gene

Forensic Context

A study in humans demonstrated that the POU2AF1 is a protein-coding gene with a down-regulated expression pattern after death, is involved in death-inducing signaling complex assembly and immune regulation, and was used in a post-mortem interval (PMI) prediction model with a negative coefficient, contributing to a model achieving a root mean square error of 4.75 hours [Antiga et al. DOI:10.1038/s41598-021-96095-z]. In a separate study in Sprague-Dawley rats, the POU2AF1 was identified as a differentially expressed mRNA present in multiple gene sets (A, C, and D) for wound age estimation following skeletal muscle contusion, and its expression profile contributed to a Random Forest classification model achieving 85.71% accuracy in external validation [Ren et al. DOI:10.1016/j.fsigen.2022.102722].