Basic Information

Symbol
PPARA
RNA class
mRNA
Alias
Peroxisome Proliferator Activated Receptor Alpha NR1C1 Peroxisome Proliferator-Activated Receptor Alpha HPPAR PPAR Peroxisome Proliferative Activated Receptor, Alpha Nuclear Receptor Subfamily 1 Group C Member 1 PPAR-Alpha PPARalpha
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis Cause of death analysis Wound age identification

MANE select

Transcript ID
NM_005036.6
Sequence length
10118.0 nt
GC content
0.4809

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-3289.80 kcal/mol
Thermodynamic ensemble
Free energy: -3468.71 kcal/mol
Frequency: 0.0000
Diversity: 2527.93
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(.((.((((((.(((((((((((((((((((((((((((.((((((.((((........))))))))))..)))))))........)))).))))).))..)).)).)).))).).))))).)))((((.((((((....((((((...((((((((.(.(((.((((((((((...((((.((((........).))))))).)))))((((((((((((.(((.............((((...((...(((.(((((......((..(((((.((.((((((...............))))))..)).)))))..))..(((((((.......)))))))))))).))).)).)))).(((((.(((((((((((.((((((((.(((((((.((....((((.((((.(((.....((..(((.((((((((.(((..((....(((....((((((((.(((((((((((((((((....))))).))))...((........))..)))))))).)))..)))))..)))...))..)))...).)))).)))..)))..))..))).))))))))...))))).)))).))))).((((((((..(((((((((....(((((........))))).....))).))))))..((((...))))...........))))))))((((((((((((.((((....))))))))....((.(((((....((((((((.((.((..(((....)))..))))...((........))..........))))))))...)))))..))......(((((((((..((((((.......((.(((((((((...)))))))((((((((.(((((..(((..........(((((..((((..(((((.......))))))))))))))....)))...))))).)))).))))...(((..(((.((((.....)))).)))..)))...........(((....))))).))))))))..)).)))))))((((.....((((.....(((((....)))))))))...))))....(((..((((.((.(((((.((((((((((..((((..(((((..(((...(((((.((((....)))).)))))..))).)))))..((((((..(((((((..(((..(((((((((((.........(((((......))))).((((((((((.(......).))))))....))))...(((((((((((..(((((((....(((((((.(((((((.(((.....)))))))))).)))...((((((((((((((((((((.(((((.(((...(((((.....((.....((((..((((((.((((((.((((.((((.((.....((((((((..(((((.........)))))(((.((.((.(((((((((......((((.((((.....((((.((((((.((((((((............)))))).((((.....)))).....((((((.......)))))).))))))))..)))))))).))))..))).)))))).)).)).))).................))))))))..(((.((((.(((((..((.(((.((((((((((((.....)))))....(((...)))....)))))))))).))))))))))).)))(((((..((((((.........))))))..))))).((((((.(((((((....((((((((((((.((((((.((....(((.(((((((((.(((......)))...................((((.(.((((((((...)))))))).))))).((((((.......((((..((((((.(((((.((((.(((((..((((((((...(((((.((.((((..((((.....))))...((.(((((((((..(.(((((((.((..(((((((.((((..((((((....)).))))))))..)).))))).....((((((....))))))(((((..........)))))....)).))))))).)...))))))))).)).)))))).)))))...))))))))(((((.((((((.....(((.....(((((((..(((..(((((((....)))))).)....)))....))))))).......((((((((((((.........((((..(((.((((...........)))))))...)))).......))))))))))))....))).....)))))).))))).......((((.((((((..(((((.((((((((...((((((....))))))....((((((((.(..((((..((((((..(((.(....))))))))))......))))..)))))))))......................)))))))))))))...))))))....))))((..(((((....)))))))))))).)))).))))).))))))..))))((.(((((((.((.......))..)))))))..)).))).)))((((((.......)))))).((((((((((..((((..........((((..((((...)))).....)))).))))..)))))))))))))).((((((((..((((.(..(((..((.((((((......)))))).)).....))).).))))..)))))))).(((....)))))))))))(((((((...((((..(((.(((((.....)))))..((((((((((.(((((((......))))).((((((.(((..(((.((((((.....(((..((((((((((((((((((((.((((((((....)))))))).))))))...(((((....((((((.(((((((...((((.((....))..))))..((((((.(((((((.......((((((..((((....))))..))))))......))))))).)))))).....))))))).))))))......)))))........))))))))))))))...))).....))..)))).))).)))))))))((((((((......(((((......(((((..(((..((((((....(((((((((...................((((..(((.((((((.......)))).)).)))..))))..(((((((....))))))).......)))))))))......((((((...))))))..((((((((.((((.((((.((((.....))))...(((((..(((...........)))..)))))((((((((........(((.(((.(((.........))).))).))).))))))))))))..(((((((((..(((....))).)))))))))....((..(((((((((...((((.((.........(((.((((((((((((.(((((((...)))))))..(((((......))))).)))))).(((((.....)))))...(((((.(((..(((...)))...))))))))........(((((((..(((((((((....)))..............(((..((((((.((..((((((((((.(((((((((.((..(((.....)))..((..((((((....))))))..))((((((((((......((((((((((((((((...(((((((.((((.....(((((((....((((((........(((((((...((((((.(((((((((.(((...((((((....))))))....((..((((((((((((..(((((((((((((((((((.(((.(((((((....(((....)))))))))).....(((.(((((..((((............))))..))))).)))...............((((((..(((((((.(((((((((((....))))..)))))))...(((((...)))))...((..((((((.....(((((........)))))........(((((.......)))))..))))))..))............)))))))))))))....(((((((((.(((((....((((((....))))))..((((((((.(((.....))).))))))))(((((.....((..(((.((((((((.....)))))...))))))))..)))))((.((((...))))...))..((((((((((..(((((.(((((..(((.((.....)))))...))))).))))).))))))))))...................(((((((......((((((((((.((..(.(.((((((((.............))))))))).)..)).((((.((....)).))))((((((((((((......((...)).......((((((....)))))).))))))))))))(((...........)))..)))))))))).....((((.(((((.(((((......(((((((((((.(((....)))))))).........((((((((...((((.....))))..)))....)))))(((...((((.....((((((((((((((((..(((((.......(((.......)))..(((((......))))).......))))).....((((..((((((((((.....((((((..................))))))..((((...........)))).....(((((((.((((((((((.....((((.((...........)).))))................(((((....))))).......(((((((.(((((....((((((.......))))))...)))))....))))))).....(((((((((.........)))))))))..(((((((.(..((((....)))).).))))))).....(((((((..((.((.((...((((((...(((((((.(((((........))))))))).)))..)).))))......))))))..)))))))....))).))))))).))))))).((.(((.(.((((((..(((.((((......((((..........((((...))))...((((.(..((((....))))....).))))((((.(((((((((((((((..(((((((((.(((........))).))))......))))).))))))..))))...))))))))).....))))...((((.((.(((((((.....)).))))).)).))))((((((((.....)))))))).)))).)))..))))))).))).))..))))))))))..))))))))))).((((.((((.(((((((....((((..(((((((((((..((((.......))))..)))))))))))..)))).....(((.....((((((....(((((............))))))))))))))...((((((((.((.....)).)))))))))))))))))))))))..(((((......).))))..(((((((((.....)))))...)))).)))))))))......))))..))).))))))))))).))))))))).........(((((((((((........)))).)))).)))..(((((.((((...)))))))))(((.((..((((((((((..((...((((...))))...))..))...))))))))..))))))))))))..((((.(((.....((((((.(((..(((.(((.((((...(((((.....((((..(((((....(((...)))((((((((((...))))).))))))))))))))(((.((.(..(..(((((((.......))))).))..)..).)).))).))))).)))).))).((((((........................))))))....(((((((...)))))))...)))..))).)))))))))))))))))).)))))))))..(((((..(.((.((.((...(((((....))))).)).)).)).)..))))).))).)))))).))).....)))).))))))))))))))))))..)).........(((((.((.((((..((((.......(((.......))))))).....)))).)))))))..(((.......))))))))))).))))....(((......))).))))))....))))))))))))))).))))).........((((((....((.....)).......)))))).......)))))))...))))...)))).)))))))(((((((((.(((.(((...........((((.((((((((((((((((((((.(((((...)).))).))))).((((((.((((((((.(((((((((....))).))....)))).))))).((((...))))........))).))))))..)))).))))))))))).))))...........((((....))))..(((((((((.(((.......)))...))).))))))....))))))..)))))))))..((((.........))))..((((((.(.(((((..(((((((...(((((((((....).)))))))).)))).))).)))))).)))))).......)))))))))))))))((((....))))..........(((.....))))).)))))))))))))))))))..)).))))))..)))..)))))))))))))..)))))).)))..)).))))...))))))))).)).))))))))))))....))))))..)))))))).....)))))......))))))))..............(((..((((((...))))))..))))).))))))))))........(((((((((.((((.......))))..((((((((((((....))).))))))))))))))))))....)))...))))...)))))))((((((.....))))))....(((.........)))........(((((.....)))))((((((((((((..(((....((((((((((........))))))))))......(((.(((((((......))))))).)))...((.(((((......)))))))....))).))))))).)).))).)).))))))))))))..))))))..))))))).))))))............((((((((((((((..(((.((((((...((((((.(((((...((((.((((..((((.........))))..)))))))).........((((.((((.(((......))).)))).))))...))))))))))).))))((((....))))...)).))).....)))))))))..)))))...)))))).))))))))))..)))).))..))))....))....))))).)))))))).)))))..(((((((((....................)))))))))...(((((((((((....)).)))))...))))((((((.((((...(((......)))..))))..)))))).............(((((..((((.....)))))))))............))))))).))))))))((((((((.(((((((((((.((((...((((((((..(((((.(((((((..(((...((((........))))...)))..........(((((.(((.(((((.((((((...))).)))))))))))....)))))))))))).((((...(((((..((((((............)))))))))))(((((.....(((((((((...(((((...)))))..)))))))))...)))))..(((((((((((.((.((((....)))).)).))))))))))).....(((((((..((....))..))))))).......(((....)))))))..))))).....(((((.(((..((((((....((((((((..................))))))))..........(((((....)))))))))))..))))))))((((.((((((((...........................)))))))).))))........))))))))....)))))))))((..((((((.(((.((((.....((((((((((((((..((((.(((((.(((((((..((((((((((((..((......))..))))))).)))))((((((.((((((((.......((((.....(((.((((((...)))))).)))...)))).(((((......)))))......((((.....((((....(((((...)))))....)))).....)))))))))(((((((((((.((.((((((......(((((.......)))))...)))))).)))))).)))))))....)))))))))..((((...((((....((((.((((((.(((((((..........................)))))..((((((((((....(((.(((...((........))..))).)))...))))).)))))((((...((....))...)))).(((((((((((((..((((((......((((((.(((((...))))).)))))).......))))))...........)))))))))))))..........(((((((..........))))))).........)).)))))).(((((.(((((.(.....).)))))))))).(((((....))))).......))))....)))))))).))))))).)))))))))..)))))))).)))))).................((((((....(((((.(((......))).)))))...............((((............)))).))))))....(((.......))))))).))).))))))..))...)))))).).))))))).((.(((((.....))))).))...........))))))))))))))))))))))...(((((((............((((((((.(.(((.(((((...((((........)))).(((((.(.((((.....)))).).)))))......))))).))).)...))))))))((((..((((...(((....)))..))))))))..(((((((....)))))))......))))))).........((.....))..............))))))).))))(((..((((((((((((....)))).))).......((((...........))))((((((((((.....((((.(((..((..((((((.......))))))................))..))))))))))))))))))))))..))).....))))))))))))))))..((((.(.(((((.....))))).)))))......))))..))))))..................((((((((((......))))))).)))...))))))))).)).)))).))).))))))))....)))..))))))))))).)))))))).)).))))))))))..((((((((((.(((((..((((((....)))))((((((......(((((((........)))))))....))))))((((((.......)))))).............((((((((.((((((...)))))).))))..)))).(((((((((((....)))...)))))))).)..))))).))).....))))))).......))))).))).).))))))))......))))))..))))))))))....((((((((((((((...)))))))))))))).
Thermodynamic Ensemble Prediction
,.((.((((((.(((((((((((((((((((((((((((.((((((.((((........))))))))))..))))))),.......)))).))))).))..))},).)).))).).))))).}))((((.((((((....((((((...((((((((.(.(((.((((((((((...((({,((((......,.).,)))))).))))}(((((((((((({((,.............((((...((...(((.(((((......((..(((((.((.((((((.,,.,.....,,.},))))))..)).)))))..))..(((((((.,....,)))))))))))).))).)).)))).(((((.(((((((((((.((((((((.(((((((.((.{{{(((,((({,,({{...}},,.,||},||||{,,..{{,..{,{{|,,|,....|{{(((((,((((({((((({(((((...,|}}}|.}}|}...||.,,.....||,,|}}})))),|}|..|}}}|||,|||||||..|}},..|||}}}.}})}}}}}})))..})),))))))))...}}))).)))).))))).((((((((..(((((((((,...(((((........))))).....))).))))))..((((...)))).,,......,.))))))))((((((((((((.((((...,))}|)))),...{{.(((((....((((((((.((.{{..(((....))).,)},,...,,........},.,.....},.))))))))...))))).,}}....,.(((((((((..((((((.{......,,{,(((((((...)))))))((((((((.(((((..{{,...,,,....(((((..((((..(((((.......))))))))))))))....},),,.))))).)))).))))...|||,.(((.((((.....)))).)))..|||,...,}},...(((....))),},),))))))..))))))))))|,,,.....,,,{.....{((({,{|{||,,,||}}..|}||}||||||||.((((.((.(((((.(((({(((((,,((((..(((({.,({{...{((((.((((....)))).))))}.,|||.}}})},.((((({..(((((({..(((..{({((((((((.....||,,.||||,.,...}})}|.{{{{{{((({.{......}.}))}))....}}}}...(((((((((((,.,((((((....(((((((.(((((((.(((.....)))))))))).)))..{((((((((((((((((((((.{{{||,|{{...(((((.....{{...,||||...(((((({(,,,,|}||||}|{{,,{{..,..{{{((((((((((({,..,.,,{{|,|||(,,.,,}}}}(((((((((......((((.((({....,((((.((((((.((((((((.,.........,)))))).((((.....)))).....((((((.......)))))).))))))))..)))))))).))))..))).)))))).,|.}}.|}}{,.,,,,,|,,,,....,}}}}|||.{(((.((((.(((((..((.(((.((((((({{(({....,|}||,....||{...,})}..,)))))))))).))))))))))).)))|((((..((((((.,.......))))))..))))}.(((((({(((((((....((((((((((((.((((((.((...,(((.((((((.{{,({,.....,)))........,,,,,,,....((({,(.((((((((...}))))))).))))).{(((((.......{(((..((((((.((({{.((((.(((({..((((((((...(((((.((.((((,,((((.....))))..,((.(((((((((..(.(((((((.{{..(((((((.((({.,((((((....)).))))))))..)).))))).....((((((....))))))(((((.{.....}}.)))))....}}.))))))).)...))))))))),)).)))))).)))))...))))))))(((((.{(((((.....{{,.,,..(((((({..{{,.,(((((({....}}}))}.,,},,)))....)))))))...,,{,((((((((((((.........((((..(((.((((...........)))))))...)))).......))))))))))))..},))},.}..)))))}.)))))..,,{{,{{(({((((({..(((((.((({((((...(((((,....}))))),,,.((((((((.(..((((..((((((..{{{.,....,}))))))))......))))..)))))))))..||.............,,.},))))))))))))}...})))))...,|||}|,..{{,||,,.,))}))}}))))).)))),}}}}|,|||}}}.,||||({.(((((((.((.......))..))))))),,)),)))})))((((((.......))))))..((((((((({,((({........,,((,,.,|||.,{{|,,}.....},)),)}))}})))))))))(((({.,(((((((..((((.{.,(({..((.((((((......)))))).))....,)}}.}.))))..)))))))))))).,..,.)))))))))|((((((...((((..(((.(((((.....)))))..((((((((((,({(((((......))))),((((((.(((.,{((,(({({(.....(((..((((((((((((((((((((((,,((((((.(({,|||..((((((|.,((((((.......)))))))))))))..}}))})))))}.}}.{{{{{.((((((.(((((((.......{{((((,,({({....}))},,)))))}......))))))).)))))).....)))))))}}}}((((({....))))}},,,)),})))))))))))))...))).....}})})))},}}),)}}))))))((((((((......(((((.,,...(((({..(((..((((((....(((((((((.......{{{{.,{{{{{{((((..(({.((((((.......)))).)).,))..))))..|||||||..,})),,,}}.......)))))))))......((((((...))))))..((((((({{((({.,{((.,{{{.....,,,,...(((((..(((...........}})..)))))((((((((........(((.(((.(({.,.....,.))).))).))).))))))))}},}..(((((((((..(((....))).)))))))))....{{..(((((((((...((((.{{.........(((.((((((((((((,(((((((...}))))))..(({{{......})}}).}})))).(((((.....)))))...(((((((((..(((...)))...))))))))........(((((((..{((((((((....)))..............,{{..((((((.((..((((((((({{(((((((((.({..(((.....)))..((..((((({....,)))))..))((((((((((.....,((((({,{{((.{{||,.(((((((,.,(((....,,{{,,.(((({(,,((.,,......,,.........}}.}}.}}||}|((({(((.{((((((.(({.,|{{{{(((.((((((((((((((((..(((((((((((((((((((.(((.(((((((...,({{....)))))))))).....(((.(((((..((((...,........))))..))))).)))...............((((((..(((((((.(((((((((((....)))),,))))}}}{{{(((({...)))))..,{{,,((((((.....,{(((........)))))........(((((.......)))))..))))}}..|.....}}.,}}..)))))))))))))....(((((((((.(((((....,,,,{{.....,||}|,.((((((((.(((.....))).)))))))){({({.....{{..{(,,(((({{((,....}})))...)))))}||{{|||||{{,{{,,{{{|,||{{{|{..,{,||,||||}.||||{.|||||}|{{{.{({{{{|},|||,,.}}}}}.}}}}}.}}))})))))..,}},,},,,.....,,.(((({(((({.,.{((({{{(({.{(,,(,{.((((({{{.....,,,,},.,))))))))},}||}}.||{{,{{,.,,)),})))|{{{{((((((({{{..(({,,{{{,.{....{(((((....)))))).|||}}}}}}|}|({{,...,,||{{{{..{{||||,,,|||....}||.,{(((((,({{(({{{{.,(((,,((((((.,(({.,{|||||}}}..............,,,...,,((((({.||.|{{|}|,...{{{{((({,.|{{,,.....((({((((,(((((({..{,{{{.......{{{,,,..,,)))|.((({{....,,))))).......}}}}|,,..,{{(|..{(((((((({.....|||{||}},.............,,)))))),||{..}},}))}}}},}}}}.,|}}|{,||,|}||||,,(((({(,..,||,}|||,..||}||||,,.}}}..)))).))..)}}}))||||,....||||,.....||{{{,,...,{{{{....((((((.......))))))}..})})}....})))))}...}}}}}}.)))).,}.{{|{{|.,,,||||{.,(({,(({.{{(((,{{{{||||{{{|||||||..{{{(((((((..((.{(.((...((((((.,.(((((({,(((((........))))))))),})).,)).)))).,,.,.})))))..))))))).,,{|||{|||}}|)|))}}}))|||,{{{,{,(({(((,,(((,((({..,.,,({{{..|||,|,,.((((...)))).|,((((.(,,,{((,,..|}}},,..,.))}}|||{.(((((((((((((((..(((((((((.(((........))).))))......))))).))))))..))))...)))))))))..,}||)))|||{(((.{(.(((((((.....)).))))).}}.)))}{(((((((.....)))))))}.}))).)}),,|||||||.|,..},},}}},}}}||||,}}}})))))}}.((((.((((.(((((({....((((..(((((((((((..((((.......))))..)))))))))))..))))...,.{{{,....{(((((....(((((.,......,...))))))))))))))..,((((((((.((.....)).)))))))))))))))))))))))..{{(({,,,,..,.))))..(((((((((.....)))))...)))).||}}|||})......,},},,.||,})))}}}}}}}.))}}}}}}}......,,,(((((((((((.,......)))).)))).)))..{((((.{{{|,.,)))))))))||{.{{..((((((((((,.((...((((...))))...)}..)),..))))))))..))}},||||,}}{{(((({,(({{{..((((,,{(((..((((,,{.,,,,...{||||}}}}.,|||}.|||||...}|||}}}.))||,,,,||||,..,}},)}),,)))))))))}}))),..}|}}|..(((((((.......))))).)).,{.....,,..)}))),)})},)})))},|||||}....,}},,.,}}},.....,,.))))))}}..|||||||,,.}}}}})).,,}})..}}}.}}})}))})))}}))))).)))))))))..(((((..{.((.((.((...(((({....})))).)).)).)).)..))))).))).)))))).))).....)))),})))))))))))))))),......,,,,,,.,,,,,.,({(({,..{(((......,({,......,)),))))},,,.||||{|||,|,,..(((({(({...))).))))),{((((.(((((({{.{,.,.{{{(,,...}})),,......,,,....{((((.......))))|((((......((((.(.{{(.{{((({,,......)))).)).}}}.),))})))))|{(((((((((((,({,.,,..((((((........((((....,.,,,,,.|}}}}}}}}},,,,....}.}))..))),))}}}||....((((((.(((((((({....})).))....)))).))))))||}}))))))))))}..{{||..|||{{{{{|.,,.})))))))),.}))),.....,.}}}}||||....,,))..,,...||)))}.)))}.))}))).))))))))))))))),))))))))))}},|}}}..((((.........))))..((((((.{.(((((..((({(((..,{((((((((....).)))))))).)))).))).)))))).)))))).},}}..}}}}})))))))))){{{({{{{||||.........,|||}}}}.},.}).)))))))))))))))))))..)).))))))..}}}..)))))})))))))..)))))).)))..)).))))...))))))))).}}.})))))))))))....))))))..))))))))...,,)))))......))))))))..............{((..((((((...))))))..))})),))))))))))........(((((((({.((((.......)))).|((((((((((({....})).))))))))))))))))))....)))...))))...)))))),((((((.....))))))....(((.......,.}}}........{((((.....))))}((((((((((({,.,||,.,.{(((((((((........)))))))))}..,,,,(((.(((((((......))))))).)))...((.(((((......)))))))....,))}))))))).)).))).)).))))))))))))..))))))..))))))).)))))).........,..{(((((((((((((,,(((.{(((((...((((((,(((({...,(((,((((..((((.........))))..))))}}}),,,......|||{.{|||,|||,,,..,})),)))).})))...})))))))))}.}))){{({....|}}}...}),))).....)))))))))..)))))..}|||)}},}}}}}}}}}},})))),}}..}|||,,..}}.,},)))),.}))))))).})}}|..,{{{{{{||,,...........,......})))))))}..,{{(((((((((....)).))))),,,)}}}{{((((.((((...(((......)))..))))..)))))),............,|{{,..|(((..,..)))}|||},....,,......))))))),})))))))|((((((,.(((((((((({{((((...((((((((.{(((((.(((((((..{{{,..,,,,....||,,|}}}.|,}}},||.,{,|,.,,{,..(((.(((((.((((((...))).})}))))))))...,,||||||}|}}}.((((.,,,{{{{..||||{|,||,...}},..))))))))})|(((((.....(((((((((...(((({...}))))..)))))))))...)))))}.{((((((((((.((.((({....)))).)).))))))))))|,....(((((((.,((....)),.)))))))....}}.{{{....)))))))..})))}.,...(((((.(((..((((((....((((((({...{{,......,...,,))))))))..........(((((....)))))))))))..)))))))){(((.((((((((...........................)))))))).)))}........))))))))....)))))))))((,{((((({{((({(({{..,,.,,,{{{,{{{{{{{..((((.(((((.(((((((..(,(((((((,((.{(.....}},)}.))))))).}}||}((((({,(((((({{.......((((.....(((.((((((...)))))).)))...)))).(((({......}))))......((((,,.,,((((....(((((...)))))....)))).,.,.)))))))))|||||{{((({.{{.{{((((.....{(((((.......}))}}...)))}}|,||}|||,|}}||||....}}}}))))}.}}|||..,{|||,..,|{{{.((((((.({(((((..........................)))))..((((({((((,,,.(((.(((...((........}}..))).))).,.))))).)))))((((...((....))...)))).(((((((((((((..((((((......((((({.(((({...))))).)))))).......))))))...........)))))))))))))........,.(((((((..........))))))).........)).)))))).,{{...{{{{(,(,,..{|.|||,,..))).}|||}},,.})))}.,.....))))....)))))))}.))))))).)))))))))..})))))))}))),,,.................,{{,{{....(((((.(((......}.)})})}),,.............((((............)))).,}||||{.{{{{{.......))))),.})))}})))))}.))...)))))).,.))))))|.{{.(((((.....))))).)),..........)))))))))))))))))))))).,.)}}}|||}....,,,,,..||||||||||||{||||,,,.,.{{{{......,,)))).....(((.((((((.,...(((....(((((({..(((......(((.(((|,{{{((((..{(,(({..(((....)))..,,,))).)}..)))))))))).))).,,}}}..)))))))....)))..)))))}.))).,,...,,,.....))))))),})}|(((..(((((({,((((....}}}}.,,...,,,|{(({(..,.,,,|,,|,|||((((((({((.....{(((.{{{,,|{..{{{||{.....,,)))))),,,.......,,,.,,)),,}}}}}}}}}})))}))))))))..)))}....))))))))))}))))).}|{{{.(.(((({,,...||}}).}))))....||}))),.)|||},,......,.,,,.....|({((((((((......)))))))),))...))))))))).)).)))).,,..))))))))....)))..))))))))))).)))))}))})}.)))))))))),,{{,(((((((((((((.((....))..))))))).).)))))...(((((((.,....,.)))))))...,,{|.|,{.,,||,.,}...,}}}},......,,,|.||((((((((.((((((...)))))).))))..)))).||.|,|,,,.,..{(((((((((((((.((,....}))))))))))))))),,,...,..,))))).))).).))))))))......)))))).,))))))))))....{(((((((((((((...)))))))))))))}.

Transcripts

ID Sequence Length GC content
GUGGACGCGGCGGCCCCGCGGCGGGGGCAGCGGGCGGCGGGGGCGGAGG… 9383 nt 0.4818
GUGGACGCGGCGGCCCCGCGGCGGGGGCAGCGGGCGGCGGGGGCGGAGG… 10118 nt 0.4809
Showing 11 to 12 of 12 entries
Summary

Peroxisome proliferators include hypolipidemic drugs, herbicides, leukotriene antagonists, and plasticizers; this term arises because they induce an increase in the size and number of peroxisomes. Peroxisomes are subcellular organelles found in plants and animals that contain enzymes for respiration and for cholesterol and lipid metabolism. The action of peroxisome proliferators is thought to be mediated via specific receptors, called PPARs, which belong to the steroid hormone receptor superfamily. PPARs affect the expression of target genes involved in cell proliferation, cell differentiation and in immune and inflammation responses. Three closely related subtypes (alpha, beta/delta, and gamma) have been identified. This gene encodes the subtype PPAR-alpha, which is a nuclear transcription factor. Multiple alternatively spliced transcript variants have been described for this gene, although the full-length nature of only two has been determined. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans demonstrated that the PPARA gene encodes a circular RNA, hsa_circ_0116795 (circ_PPARA), which is highly expressed in the peripheral blood of patients with acute myocardial infarction (AMI) and in hypoxic human cardiomyocytes, is resistant to RNase R, and shows an area under the curve of 0.876 in ROC analysis for distinguishing AMI patients from healthy controls [Huang et al. DOI:10.1186/s40001-024-01753-3]. Another human study found that the PPARA transcription factor had low expression in the peripheral blood of sepsis patients, where its expression was positively correlated with 28-day survival rate, and it was identified as a core protein in a PPI network related to cytokine-mediated signaling pathways [Liu et al. DOI:10.0000000000002072]. A study in mice, rats, and other models demonstrated that the PPARA is transiently increased at wound edges after skin injury and its activation preserves kidney structure and reduces inflammation after ischemia/reperfusion injury, with protective effects also reported in liver, brain, and heart models [Michalik, L.; Wahli, W. DOI:10.1172/JCI27958]. In human sepsis patients, RNA-seq analysis of peripheral blood showed the PPARA had low expression compared to healthy controls, and its expression level was positively correlated with patient survival rates, with single-cell sequencing localizing its expression to monocyte, NK-T, and B cell lines [Liu, Jitao; Li, Shaolan; Xiong, Dianhui; Shang, Wenjun; Zhan, Tao; Zhu, Xingxin; He, Sheng; Wang, Yu; Zhang, Qian; Hu, Yingchun DOI:10.0000000000002072].