Basic Information

Symbol
PPBP
RNA class
mRNA
Alias
Pro-Platelet Basic Protein SCYB7 CTAP3 CXCL7 MDGF LDGF TGB1 PBP Platelet Basic Protein Beta-TG CTAPIII LA-PF4 THBGB1 B-TG1 NAP-2 TGB Connective Tissue-Activating Peptide III Chemokine (C-X-C Motif) Ligand 7 Macrophage-Derived Growth Factor Leukocyte-Derived Growth Factor C-X-C Motif Chemokine 7 Beta-Thromboglobulin NAP-2-L1 Small Inducible Cytokine Subfamily B, Member 7 Neutrophil-Activating Peptide-2 Low-Affinity Platelet Factor IV Neutrophil-Activating Peptide 2 Small Inducible Cytokine B7 Small-Inducible Cytokine B7 Thromboglobulin, Beta-1 CXC Chemokine Ligand 7 Thrombocidin 1 Thrombocidin 2 CTAP-III THBGB TC1 TC2
Location (GRCh38)
4:73985966-73988276
UCSC Genome Browser Search in Marker Scope
Forensic tag(s)
Sudden cardiac death diagnosis Tissue/body fluid identification Sudden death from CNS diseases
External database
HGNC NCBI Ensembl OMIM UniProt GTEx

MANE select

Transcript ID
NM_002704.3
Sequence length
1307.0 nt
GC content
0.3565

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-279.80 kcal/mol
Thermodynamic ensemble
Free energy: -308.07 kcal/mol
Frequency: 0.0000
Diversity: 283.82
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.....((((((....)))))).(((((.....((((.....))))..((((((((((((...(((.(((.(((((.............)))))...))).))).......(((.((((....(((((.(.(..((((((..((..((((((.((....)).)))).))..)).....((((.((((((((((((......((......)).........(((.(....).))).)))).))).)))))))))((((((..(((((((.((((..(..(((........)))..)..)))).))))((((....((.(((((...))))).))....))))..((...))...)))..))))))))))))....)).))))).)))).)))..((..(((((........)))))..)))))))))).))))..(((((.((((..(((((((((((.....))))))))))).....(((((((((((((((....(((((((((((.....((((((((((..(((....((((.....((((((...(((.((((((((((((...........))))).....))))))).)))....))))))..))))...))).)))))))))).....))..)))).)))))))))))))....((((((((...........(((((((......(((((((((((........))............((((((......)))))).((((...((((.((....(((.((((......)))).)))...)))))).)))).....((((((.((((((........)))))).)).))))...)))))))))..))))))).((((((((.((((.....))))..)))))))).....((((((((..(((..(((((((...((.((...(((((((...(((((((((((..........(((..(((((((((((((.(((((((((..........)))))))))......((((((((((...(((.((((((((.....)).)))))))))....))))))))))(((((((((.....(((..((.......))..)))......))))).))))...........))))))))))))).))))))))))).)))...)))))))...))))....)))))))))))))))))).......)))))))).))))))).........................................))))))))).....(((....)))........))))).....
Thermodynamic Ensemble Prediction
.....,(((((....)))))}.(((({.....((((.....))))..((((((((((((...(((.(((.(((((.............)))))...))).)))....,..(((.((((....(((((.(.,..((((((..((..((((((.((....)).)))).))..)).....((((.((((((((((((..,,..,|,.....||,,,.....}}|||{....,,}...))))}}}),)})))))))((((((..(((((((.((((..{..(((.,......)))..}..)))).))))((((....((.(((({...})))).))....))))..{{...}}...)))..))))))))))))....}).))))).)))).))).||{..(((((........)))))..}}))))))))}}))}..,{{{(,((((..(((((((((((.....))))))))))).....{{||||{((((((({..,,(((({{{{,,,{||,,||||||||{{{{((({,...{{{.,}},.|||||,.,||,.,,|||||||{{{.|||||,...,},,,,.....,}}}}}}.}}}...|},|||,{((({,{{{,....,,}}..,.)))))})).,))}||||||||)))))||,,..((((((((.......,...(({{(((,,,.,,((((,,{{,{{.....,,,)),.{(({...,}}|,{(((......))))},.,,,,...{{{,.{,....|||,||{{....,.)))}.}}}...}}}}},.}))}..,..{{{(((,({((((..,,,,,,}}}}}}.}},,})),..}})))))),.,)))}))),|,,{{{{,.,,,,.,,.,,,,|.,,}}}))),.....((((((((..{{{..(((((((...((.({...(((((((...(((((((((((...........,,..(((((((((((((.(((((((((..........))))))))).....{((((((((((...(((.((((((({.....}).)))))))))....))))))))))}.,,(((((.......{,,{(,,{,...,,...,,..,,},))))},|||,.......}}}}))))))))))))).}}.)))))))).)))...)))))))...}),,.,..)))))))}}})))))))).......)))))))).}}}}}}),,,,..,,,,,|||||......,,,,...............}}}}}}}},.....{{{....))}........))))).....

Transcripts

ID Sequence Length GC content
NM_002704.3 NCBI
ACUUAUCUGCAGACUUGUAGGCAGCAACUCACCCUCACUCAGAGGUCUU… 1307 nt 0.3565
Summary

The protein encoded by this gene is a platelet-derived growth factor that belongs to the CXC chemokine family. This growth factor is a potent chemoattractant and activator of neutrophils. It has been shown to stimulate various cellular processes including DNA synthesis, mitosis, glycolysis, intracellular cAMP accumulation, prostaglandin E2 secretion, and synthesis of hyaluronic acid and sulfated glycosaminoglycan. It also stimulates the formation and secretion of plasminogen activator by synovial cells. The protein also is an antimicrobial protein with bactericidal and antifungal activity. [provided by RefSeq, Nov 2014]

Forensic Context

A study in humans demonstrated that the PPBP is a highly expressed, platelet-enriched transcript in patients with acute myocardial infarction [Eicher et al. DOI:10.3109/09537104.2015.1083543]. A separate forensic investigation in humans validated the PPBP as a novel, blood-specific mRNA marker for body fluid identification, showing high sensitivity and specificity in a multiplex qRT-PCR assay and successful integration with DNA/RNA co-extraction and STR analysis [Park et al. DOI:10.1016/j.fsigen.2012.09.001]. A study in human traumatic brain injury (TBI) patients demonstrated that the PPBP mRNA was one of the five most significantly up-regulated mRNAs in TBI tissue compared to adjacent control tissue, a finding confirmed by quantitative real-time polymerase chain reaction [Yang et al. DOI:10.4103/1673-5374.247467].