| ID | Sequence | Length | GC content |
|---|---|---|---|
| GUUUUGCAGACGCCACCGCCGAGGAAAACCGUGUACUAUUAGCCAUGGU… | 2394 nt | 0.4570 | |
| GUUUUGCAGACGCCACCGCCGAGGAAAACCGUGUACUAUUAGCCAUGGU… | 2237 nt | 0.4595 |
This gene encodes a member of the peptidyl-prolyl cis-trans isomerase (PPIase) family. PPIases catalyze the cis-trans isomerization of proline imidic peptide bonds in oligopeptides and accelerate the folding of proteins. The encoded protein is a cyclosporin binding-protein and may play a role in cyclosporin A-mediated immunosuppression. The protein can also interact with several HIV proteins, including p55 gag, Vpr, and capsid protein, and has been shown to be necessary for the formation of infectious HIV virions. Multiple pseudogenes that map to different chromosomes have been reported. [provided by RefSeq, Jul 2008]
A study in human cadavers demonstrated that the PPIA was analyzed as a candidate reference gene for mRNA normalization in myocardial tissue, pericardial fluid, and blood, where it was compared for stability against other housekeeping genes [Gonzalez-Herrera et al. DOI:10.1016/J.Forsciint.2013.08.001]. A subsequent review noted that the PPIA has been identified as an endogenous reference mRNA with relatively high transcript stability in post-mortem human tissue [Scrivano et al. DOI:10.1007/s00414-019-02125-x]. A study in human postmortem cardiac tissue demonstrated that Peptidylprolyl isomerase A (PPIA) serves as a stable endogenous reference gene for mRNA normalization in quantitative PCR analyses, validated by geNorm with an M value of 0.665, indicating its postmortem stability in heart tissue [Wilmes et al. DOI:10.1007/S00414-019-02051-Y]. In a separate human study on prostate tissue, the PPIA was mentioned as a metabolic gene selected for stability in multiple studies for postmortem interval estimation, though it was not experimentally investigated in that specific work [Javan et al. DOI:10.1038/s41598-025-29561-7].