| ID | Sequence | Length | GC content |
|---|---|---|---|
| CUCAGCUGUCCGGGCUGCUUUCGCCUCCGCCUGUGGAUGCUGCGCCUCU… | 893 nt | 0.5398 |
The protein encoded by this gene is a cyclosporine-binding protein and is mainly located within the endoplasmic reticulum. It is associated with the secretory pathway and released in biological fluids. This protein can bind to cells derived from T- and B-lymphocytes, and may regulate cyclosporine A-mediated immunosuppression. Variants have been identified in this protein that give rise to recessive forms of osteogenesis imperfecta. [provided by RefSeq, Oct 2009]
A study in humans identified PPIB as one of the two most suitable reference genes, alongside FPGS, for normalizing qPCR data in an analysis of gene expression following gamma-hydroxybutyric acid intake, as determined by geNorm, NormFinder, and BestKeeper algorithms [Mehling et al. DOI:10.1007/S00414-017-1609-3]. In a separate human study, PPIB was validated as part of the most stable combination of three reference genes for normalizing qPCR data in the forensic analysis of diurnal gene expression for estimating the time-of-day of bloodstain deposition [Gosch et al. DOI:10.1016/j.fsigen.2023.102915].