Basic Information

Symbol
PPIB
RNA class
mRNA
Alias
Peptidylprolyl Isomerase B CYP-S1 SCYLP CYPB Peptidyl-Prolyl Cis-Trans Isomerase B S-Cyclophilin Rotamase B OI9 Cyclophilin B EC 5.2.1.8 PPIase B PPIase B Peptidylprolyl Isomerase B (Cyclophilin B) Epididymis Secretory Protein Li 39 Cyclophilin-Like Protein HEL-S-39
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses Time since deposition estimation

MANE select

Transcript ID
NM_000942.5
Sequence length
893.0 nt
GC content
0.5398

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-311.07 kcal/mol
Thermodynamic ensemble
Free energy: -328.32 kcal/mol
Frequency: 0.0000
Diversity: 159.51
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
......(((((.(((((((.((((((((((((.......((((((((((((...(((...((((.(((((........).)))).)))).)))((((((.(((((((((....(((((.(((....))))))))....).))))))))..)))))).....((((.....))))..(((((((.......(((..((((((((((..(((((((((.((((((.(((((((......((((((.....)))))).........((((((....)))))))))))))..(((.((.(((........))).)).)))((((((...((...))...))))))(((((.(.(((.(((((.....((((....((..((.((((.(.((.((......)))).)))))))..))....))))....)))))..)).).).)))))(((.((..((...))..)).))).))))))))))..)))))..))..)))))))).)))..)))))))..((((..(((((((.(((((((...))))))).))....))))).))))..))))).))))))).)))))))).)).....)).)).))))).)))))....((((..((((((((....(((((((...((((...((((((.(((((.(((((.((((...((......))..)))).)))).).))))))))))).)).)))))))))((((((((((........))))))).))).(((((((((....)))))).)))....((.((((.(....).))))))))))))))..)))).....((((((((((((..................................)))).))))))))..............
Thermodynamic Ensemble Prediction
.{(((.(((((.(((((((.((((((((((((.......((((((((((((,..(((...((((.(((((........),}))).)))).)))((((((.(((((((({..{.(((((,(({....}))))))).}..}.))))))))..)))))){{({{((((.....)))).})}|||,({......,{|,.((((((((((..(((((((((.((((((.(((({((,.....((((((.....))))))......,,,((((((....)))))))))}}}}..(((,({.(((........))),}),))){(((((...,,...}}...))))))||.(({.((((.,(((({{...{,(({({.{......,......,)}))}.,)))))),.))))))),.,}||..(((({...)))))..||.|{((((..(((.....)))..))))..}}.}).))))))))))..)))))..))..)))))))).},...})},,,...((((..(((((((.(((((((...))))))).))....))))).)))).,))))).))))))).)))))))).)).....)).)).))))).)))))....((((..((((((((....((((((,.,{((({...((((((.(((((.(((((.((((..,.{....}.}...)))).)))).).))))})))))).)}.)))))))))((((((((((.,......))))))).))).(((((((((....)))))).)))....((.((((.(....).))))))))))))))..)))).....{{,...,..,,,|...................)))).....{(((((((({....))))}))))}.,,.....

Transcripts

ID Sequence Length GC content
CUCAGCUGUCCGGGCUGCUUUCGCCUCCGCCUGUGGAUGCUGCGCCUCU… 893 nt 0.5398
Summary

The protein encoded by this gene is a cyclosporine-binding protein and is mainly located within the endoplasmic reticulum. It is associated with the secretory pathway and released in biological fluids. This protein can bind to cells derived from T- and B-lymphocytes, and may regulate cyclosporine A-mediated immunosuppression. Variants have been identified in this protein that give rise to recessive forms of osteogenesis imperfecta. [provided by RefSeq, Oct 2009]

Forensic Context

A study in humans identified PPIB as one of the two most suitable reference genes, alongside FPGS, for normalizing qPCR data in an analysis of gene expression following gamma-hydroxybutyric acid intake, as determined by geNorm, NormFinder, and BestKeeper algorithms [Mehling et al. DOI:10.1007/S00414-017-1609-3]. In a separate human study, PPIB was validated as part of the most stable combination of three reference genes for normalizing qPCR data in the forensic analysis of diurnal gene expression for estimating the time-of-day of bloodstain deposition [Gosch et al. DOI:10.1016/j.fsigen.2023.102915].