| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACUCGGCCUUCUGGGCGCGCGCGACGUCAGUUUGAGUUCUGUGUUCUCC… | 2196 nt | 0.5323 |
The protein encoded by this gene is a member of the peptidyl-prolyl cis-trans isomerase (PPIase) family. PPIases catalyze the cis-trans isomerization of proline imidic peptide bonds in oligopeptides and accelerate the folding of proteins. This protein is part of the mitochondrial permeability transition pore in the inner mitochondrial membrane. Activation of this pore is thought to be involved in the induction of apoptotic and necrotic cell death. [provided by RefSeq, Jul 2008]
A bioinformatic analysis in Homo sapiens identified the PPIF as a candidate gene via Random Forest and SVM-RFE algorithms, though it was not selected as a final diagnostic hub gene for acute myocardial infarction [Xu et al. DOI:10.1097/MD.0000000000045611]. A study in humans demonstrated that the PPIF mRNA was up-regulated by 46% in pericontusional brain tissue from a patient with cerebral infarction (I5) following traumatic brain injury [Michael et al. DOI:10.1016/j.jocn.2004.11.003], while a separate human study on abdominal subcutaneous adipose tissue found the PPIF was up-regulated in response to a 7-day overfeeding intervention [Shea et al. DOI:10.3945/ajcn.2008.25970].