Basic Information

Symbol
PPIF
RNA class
mRNA
Alias
Peptidylprolyl Isomerase F CypD Cyclophilin D Cyp-D Peptidyl-Prolyl Cis-Trans Isomerase F, Mitochondrial Mitochondrial Cyclophilin Cyclophilin F Rotamase F EC 5.2.1.8 PPIase F HCyP3 CyP-M CYP3 Peptidyl-Prolyl Cis-Trans Isomerase, Mitochondrial Peptidylprolyl Isomerase F (Cyclophilin F) Cyclophilin 3 CyP-D
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis Mechanical injury analysis Other applications

MANE select

Transcript ID
NM_005729.4
Sequence length
2196.0 nt
GC content
0.5323

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-761.50 kcal/mol
Thermodynamic ensemble
Free energy: -805.42 kcal/mol
Frequency: 0.0000
Diversity: 481.47
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
....(((.....(((((((((.((((...((..(((.........)))...))...)))).))).......))))))(((.(((((((((((.(((((((...)))).))).))))((((((.....((((..((((((((((..(((((((...(((((((.(((((.(((((.((((((((((..(((((........(((.(.((((((.((........)).)))))).).))).....)))))..)))).(((.((((.(((((((((((..((((((((.((((........)))).)))...........((((((((....((((....((((((..(...)..))))))))))...))))))))....)))))))))).)))))).)))).)))(((((..(((((((.((((.((((.((((((....((..(((....(((......).)).(((((((.(((.(((((...(((((((((..(((........))).....)))))))))((((((.((((..(((((.((...(((.........))).)))))))((((((((((..((((((.(.((((....))...)).).))))))(((((((((............((((((.((((...)))).))))))..((((.((((((.(((....((.((((((((.(((.(((......((((((((((((((((((((....((....))..))).))).))))))...))))))))...((((...))))..(((((.((........)).)))))..))).))))))))))).))..(((((((((..(((.(((........))).))).((((..((......))..)))).........)))))))))..............))))))))).)))))))))))))....((((...((((..((((((((((......(((((.((((....)))).))..)))))).))))))).))))))))))))))))))......(((........)))..(.(((((.(((.(((.(((((.....((((((....((..(((((...((..((((....))))..))...)))))..))......))).))).....))))).))).)))))))).)))))))))))..(((((((((((..((.((((((.((.(......))))))))).))..)).)))))))))))))).))))))))))..)))..))...)))))).)))))))).))))(((((....))))).........)))..))))).)))))).(((((((....((((((.(((.(((((...........(((.((((.(....((((((((......(((((((((..((((.......))))...(((((((((..(.((((((((((.......(((((..((((..(((((.........))))).)))))))))((..((.(((((........))))).))..))....((((((((.(((((.......))))).))))))))..((((((..(((.((((((...)))))))))))))))((((((..(((...(((((((.......((((((.....(((((....)))))))))))...(((((.((((((((............(((((((....(((((......((((((....))))))...)))))....))..)))))))))((((..(((.....)))..))))))))..)))))..))))))).....)))..)))))).....)))))))))).)..)))).)))))))))))))).....))).)))))).))))))).))))).))).)))))).))))))).))))).)))))))))).))...))))))).)))..))))))).))))....(((((((..(((((((((......((((((((.....((((((((((((........)))))))((((........)))).....))))).......))))))))..)))).)).............)))....))))))).....(((((((..(((....))))))))))))))))..)))))))...)))...(((((.....)))))........))).((((((....))))))......
Thermodynamic Ensemble Prediction
....(((....,((((({({(,((((.({(...,,...}}}})}.,.,..,)).}}}|||.}}}..},,.|||}}}}|||.(((((((((((.(((((((...)))).))).))))((((((,(((((((,,,,.,{({{(({..(((((((...(((((((.(((((.(((((.((((((((((..(((((......{.(((.{.((((((.((.,....}.)).)))))).).))).}...)))))..)))).(((.((((.(((((((((((..((((((((.((((........)))).))).....,}}}}.((((((((....((((....((((((.{....}..))))))))))...))))))))..,.)))))))))).)))))).)))).)))(((((..(((((((.((((.((((.((((((.,,.((..(((,,..,,,,,,,,.}.}|.(((((((.(((.(((((.,.((((((({({{({,..,.{,..}||....}))))})}},|||||..{|||.}||{{|,{{...{{{,,,,,,,..}}|.|||||}}(((((((((({.({((,{{({{,,{..}})}.,.,|,}{||}}}|(((((((((............{(((((.((((...)))).)))))}..((((.((((({{(((....((.((((((({{(((.(((......,(((((((((((((((((((.,{,({..,,))..))).))).))))))...)))))))}.{{(((,.,{||}|..{{||{,||,.,,,...}},}})))},))).))))))))))).)),.(((((((((..{...(((.((((((.....{{|.,((.....,,....,),,,,)))))))))..))))))))).}..,........}))))))))).))))))))))))).,,,,}|||,,((({..((((((({((,....,({(((.((({....}))).)}..,))})).))))))).)))))))))))))))))).....,|||,.......,,,..|.(((((.(((.(((.(((((.....((((((.,..,(({({({{{{{(({.{((,....))))}}))...}}})))},).,....))),})).....))))).))).)))))))).}}}))))))))..(((((((((((..((.((((((.((.,......,)))))))).))..)).)))))))))))))).))))))))))..}))..))),.)))))).)))))))).))))(((((....))))),|....,}.}}}..))))).)))))).(((((((....((((((.(((.(((((.......,,..{({.{(((.{....(((((,{{..,...(((((((((..((((.......))))...(((((((((..{.((((((((({..{{,,((((((..((((..(((((.........))))).))))))))),}}.{{.(((((........})))}.||{((({.,,((((((((.(((((.......))))).)))))))).,}.})))}.|||{((((((...,,||||,||||,,|{(((({(,{{((,.,(((((({.......((((((,....(((((....)))))))}}}},,.{{{{{,{{{|||{|||,,|,|,}}..(((((((....(((((......((((((....))))))...)))))....})..)))))....{{{{..|{{,.,,.)))..))))}}},..}}},,..)))))))}}..,}))}.))))))..}}})))))))))).}..)))),}))))))))))))).....))}}))))),,))))}}}.))))).))).)))))).))))))).))))).)))))))))).))...))))))).)))..}}}})))))))}....{((((((..(((({{(({......((((((((.....(((((({(((((........))))))}((((........))))....,))))).......))))))))..))}).))..|,........})))....))))))).....(((((((.,,((...,)),)))))))))))))..)))))))..,||.,{.(((((.....)))))},.}},..))).{((({,....,}))}}......

Transcripts

ID Sequence Length GC content
ACUCGGCCUUCUGGGCGCGCGCGACGUCAGUUUGAGUUCUGUGUUCUCC… 2196 nt 0.5323
Summary

The protein encoded by this gene is a member of the peptidyl-prolyl cis-trans isomerase (PPIase) family. PPIases catalyze the cis-trans isomerization of proline imidic peptide bonds in oligopeptides and accelerate the folding of proteins. This protein is part of the mitochondrial permeability transition pore in the inner mitochondrial membrane. Activation of this pore is thought to be involved in the induction of apoptotic and necrotic cell death. [provided by RefSeq, Jul 2008]

Forensic Context

A bioinformatic analysis in Homo sapiens identified the PPIF as a candidate gene via Random Forest and SVM-RFE algorithms, though it was not selected as a final diagnostic hub gene for acute myocardial infarction [Xu et al. DOI:10.1097/MD.0000000000045611]. A study in humans demonstrated that the PPIF mRNA was up-regulated by 46% in pericontusional brain tissue from a patient with cerebral infarction (I5) following traumatic brain injury [Michael et al. DOI:10.1016/j.jocn.2004.11.003], while a separate human study on abdominal subcutaneous adipose tissue found the PPIF was up-regulated in response to a 7-day overfeeding intervention [Shea et al. DOI:10.3945/ajcn.2008.25970].