Basic Information

Symbol
PPM1E
RNA class
mRNA
Alias
Protein Phosphatase, Mg2+/Mn2+ Dependent 1E CaMKP-N POPX1 Partner Of PIX 1 KIAA1072 PP2CH Ca(2+)/Calmodulin-Dependent Protein Kinase Phosphatase N Nuclear Calmodulin-Dependent Protein Kinase Phosphatase Protein Phosphatase 1E (PP2C Domain Containing) Protein Phosphatase 1E Partner Of PIX-Alpha Partner Of PIXA CaMKP-Nucleus CaMKN Protein Phosphatase, Mg2+/Mn2+ Dependent, 1E EC 3.1.3.16 CAMKPN CAMKN
Location (GRCh38)
Forensic tag(s)
Postmortem interval inference

MANE select

Transcript ID
NM_014906.5
Sequence length
6560.0 nt
GC content
0.4224

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1917.20 kcal/mol
Thermodynamic ensemble
Free energy: -2038.94 kcal/mol
Frequency: 0.0000
Diversity: 1543.93
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
....(((((............((((((((((((((.(((((((((.((((((((..(((((.((((((((.......((((.((...........((((.....))))...........)).))))))))))))....(((((........))))).(((....))).........)))))((((....)))).......))))).)))..)))).))))))))).(((((..((((..((((....((...((((...((....(((((((((.(((...(((..(((....(((......)))....)))..)))))))).)).)))))....))....))))..))...))))..)))).)))))((((((.(((((((((((((.(((((.(((((((...(((((((...((((((((.((((((((((((((((((((((.(((((...((((((((((...(((((...)))))...)))))))))))))))(((((((((.((.((((((((((((((((((..((((.....)))).......)))).))).)))).))))))).)).(((..(((.((..(((((((((...........................)))))))))....)))))..)))..............(((((.(((..((((((((..((((...(((....)))....))))...))))))))))).)))))...(((((((...............))))))).((((((((.....)).)))))))))))))))............))))))(((((((((...((((((....(((....))).(((.((((((.......))).)))))).......(((((....)))))((((((.((.........((((((((((((((((((.(((....(((((.((.......))..)))))..)))))(((((((.(((((((....))))))).)))))))....(((((((((((((((((.(((((((....(((((((((((((((.(..((((((((....))))))))).)))))).))......(((...(((.....)))))).))).))))......(((((...(((((.((((((..(((((.(((.((((((((((...)))))((((((((.........)))))))).))))).)))))))).)))..))).)))......))...)))))...((((((((.....(((....((((((((.(((.(((.((..(((((((((((((((((((((.(((((..(((((..((((.(((((.((((((((((((((...(((((..((.((((((...(((((....)))))..)))....))).)))))))..))))))))...)))))))))))...((((...((((......))))...))))..))))..)))))....))))).)))).(((((.((((.....((.....)).....)))).))))).(((....)))((((......))))...((((.((((((.((((((((.(((((...))))).....((((.....(((....))).....)))).((((....(((((((((((((((...(((((.(((....))).))))).((((.((((.....((((...(((((.......)))))............)))))))).))))..(((...((((((.((..((((......)))).)).)))))).)))))))).))))))))))....)))).))).))))).)))........))).))))......)))))))))(((.............)))......)).))))))..)).))))))))))))))....)))....))))))))))))))).))..((((.......)))).....)))))))))).)))))............(((.(((((((.((.....))))))))))))((((((........))))))..)))))))).....))))))))......)))))))))))))).)))))))))(((((((...........)))))))((((((((...((((((((((....((.((..((((((((((((((((..((......))..))))).........((......))....((((((((((((((((((.....)))).((((((((...((((((....))))))((.........))..)))))))))))))).))))))))(.(((.(((((.(((((((((((((..((((((((((((((((((((((((((((((.((.........((((......))))....)).)))))))(((((((...(((((((......)))).........)))...))))))).....(((((((((.((((((..((((((..((((.(((..((((...........))))(((...(((((....)))))..)))..((((((((((((...((((..((((((((((.............((((.((((((........((((((((((......)))).......(((((.......)))))..((((....))))))))))..................((((((((((..((((.............(((((((((....((((((....(((....((....(((((((.(((.(((((((((....((.(((((((....))))))).)).....))))).)))).))).)))))))....)).....)))....)))))).......))).))))))...............))))..)).))))))))....(((((((............))))))).....(((((.((((((((((((((((.((((((.((.((....)).))..))))))...))))).))))))(((((......))))).))))).)))))........(((((((......))).))))......)))))).))))((((((.....))))))..))))))))))))))...)))))))))))).....)))))))....))))))))))))..)))))))))..((((((((.((((((((((........)))))))...))).)))))))).))))))).))))))))))(((((((.(.................).))))))).....((((.....((........)).....)))).......................))))))))))))))))((((.((((....(((((....)).)))...)))).))))....((((((((((((((((.((.(((.......))).))))))))))))))))))...))).))))).))).).....(((((((.(((((((..((((((((....((((.(((....)))))))......))))..))))..)))))..(((((..(((((..........(((((....))))).(((((.....((((((.(((((((((((((((((.(((.((.(((((..(((((((......))).)))).....)))))..)).))).)))))...)))))))))))).)))))).....)))))(((((((.......)))))))))))).))))))).)))))))((((((((....(((((((((...))))))).))...((((((((....((((((((.((....((((..((((...((((...(((....)))))))...))))..)))).....)).)))).))).)....)))))))).(((((....((((....((((((((((...)))).)))))).....))))......((((((.......)))))).........))))).((((..((((.(((.((((...)))).)))))))))))...............))))))))((((((((......))))))))....(((((((((.....)))))))))...)))))).)))))..))))..))))))))))...)).)))))).....))))))))))))).)))..)))..(((((((....((.((((...)))))))))))))..)))))...)))))))....))))).)).))))).)).....)))))))).)))...)))))).......((.(((((((((((..........(((.(((.((((((((((.................(((((((......(((((((((((((((((((.....))..))))))......((...))(((((...(((((....)))))...)))))...)))))))).)))....)))))))(((((((((((((((((((...((((((((((.((.....((((((.(((......(((((((((..((((.((((((((((((((((..((((((((((........))))))).....)))..))))(((((.((..(((((((((((((((....((((((((((((..((((.............))))....))).((((........))))...((((((......((((........)))))))))).(((((...((((((((((..(((((((((((.((((((.....))))........................((((.((((..(((.((((.....((((((.((((((.....)))))).....((((.(((.((....)).))).))))...(((((.((((...)))).))))))))))).....)))).)))))))))))....(((((((.(((((((....))))))).))))))).......)).)))))))))))..)).))))))))..)))))....)))))))))....)))))(((((...((((((...((((((....))))))...)))))).)))))...))))))))))..)).)))))...................((((((((((((((.......))))))..))))))))....(((((..........)))))..((((((((((((...(((.(((.((((((((((((.((.(((((((((((...............(((..((......))..))).....((((((.((((......((((((((..(((((((........)))))))...(((((.....)))))......(((((((((....(((((.....))))))))))))))))))))))))))))))))...(((((((((((((....(((((((.(((.((((.......(((..((.....))..)))....((((..(((((.......)))))..))))(((((...(((....)))...)))))(((((......)))))))))..(((((((((((((((((...)))))........((((((.((((((......)))))).)))))).......))))))))))))....))).)).))))).....((.(((.......)))))......((.((((((((((((((((.((......................)).))))))..)))))))))).)))))))))).))))).)))))))))))))...))))))).))))).))).)))((((.......))))((((..(((...((((.(((((..((((.((((.((((...)))).))))))))....(((..(((((((..((((........)))).))))))).)))...)).)))))))...)))..)))).......))))))).))))).))))))))))))..(((......))).)))))))))))))......)))))))))..)).)))))))))).(((((((..(((....))).))))))).....)))))..)))).))))))))))(((((...((......))...)))))...........(((((.....))))).((((((.(((.....(((......)))))).)))))).(((((..(((((.........))))).))))).(((((......)))))((((((..(((............)))..))))))((....)))))))))))).))).))).........)))).....((..(((((.(((..........))).)))))..))..........)))))))..))((((((((((((...(((((((((.(((.((((((....((((......)))).....))))))...))).)))))))))......)))))))))))).............((((((....((((..............))))....))))))..))))))))))....(((((((....))))))).......((((((((..........))))))))................)))))..............
Thermodynamic Ensemble Prediction
.{((((.(((...{{{({{.(((((((((({.(((((({((.......})))},.,))}}|,||{...|||||....},)}}}......{(((((((((((((((({..(((({,((,((({(((((((,(((.{{({(({((....,,..)))})})}))).))).,....,|{,{{(((((((((((((|...,))){((({(.(|{{((.(|.(((.((..((((.....))))..)))))..)|))))||)}..))),..{(((..,((..,.((({(((((,(({,,..(({.{.{{,,,...}),).})))))))).)))}))))....))....)))).))))))))})}.,)))))))),)),)).)),))))),,,.({........)}))))))),}))))).(((((((((((.(((.{.((.((.{((((.,({{((((((.(((((((((((...(((((...)))))...))))))))))).))))...)).})).))))}.)),)).}.))).))))))))))).))))).)))}..,{({.((((((({,{(((....)))|((..(((.((..(((((((({...,,,..................,,,)))))))))....)))))..)),,.,,.,,{{{,{{,(((((.(((..((((((((..((((...(((....)))....))))...))))))))))).)))))...(((((((...............)))))))(((((((((.....)).))))))).(((((((.({,....}})...((((...))))..)))))))......{{,,,..}},.,},,,(((((((((.((.((({(((((,.{((.,(((((....))))).)))))))).,.......,{.(((((......))))).,|{||||......},,.},.,))))).))))))))).{((((((.(((((((....})))))}.))))))))))))))).}}}..}},.,),..))).))))).((((..|,,((({((,(..((((((((....)))))))).,)))))).,)..))))(((({.{{{.....)))((((((..((((((((((.((((((((((....))))}..(((((.(((.((((((((((...)))))((((((((.........)))))))).))))).))))))))..,....(((((((((.......({{((.,..((((((((.....(((....((((((((((((.(((.((,{((((((((,,,,(((({((((.(((((.,(((((..((((.(((((.((((((((((((((...(((((..((,{,,,,,.,,{{{{,..,,|||}}..,}}|||.}}),)))))))..))))))))...)))))))))))...((((...((((......))))...))))..))))..)))))..,.))))).|}},.,(({(,((({{{{{,((.....}}.....,,{{..(((((.((((((((.((((......))))...)))).)))).}))))..))..{{{{{..,})))),|||.,|}||||{(((((.,..(((((..(((....)))..)))))..}.))))))},..,}}}})}.,{..(((({....}))}),.|,....,.||||{||{||,,,..,....((((((((((((.((.((((((.{(({{{..{{.,..((((...)))).{|{{......)))).....)))))).)).)))).)))).))))....||{{|{|,{,,{},|||||||{.,}}...,}},)))..}})))})))),}}}}}.}}},,}.},,,)))}.....))}}})))).})).))))))))))))))....)))....))))))))..}})))).((((((((((((....(((((({....}))))))(((.((((...,(..(((((.(((((((.((.....))))))))))))))..,))))))).)))))))..)))))))))))))).(((((((((....(((..((((((((((((((,{{.{{{{{{{,,,..,,,,,,|||}}}},{{(((((...((((((((((....((.((..((((((((((((((((..((......))..))))).........((......))....((((((((((((((((((.....)))).((((((((...{(((((....)))))|((.........)),.)))))))))))))).))))))))(.(((.(((((.(((((((((((((..((((((((((((((((((((((((((((((.((.{...{...((((......))))..,.)}.)))))))(((((((......((((......)))).....,,,.,},..,))))))).....(((((((((.((((((..((((((..(((,{((({((....}}},,,,{{,.{({((({..,,,((,.,{|}||||.|||,,,{((({{{{{{|...{{{|.,||||||||,,.|,,,}}},}}}}||||,{,{(((....,,,.((((((((((,....,}})).......(((((.......))))).,((({....))})))))))..........,,,,....((((((((((,.,,,||,...........(((((((((....((((((....{({....((....(((((((.(((.(((((((((.,..((.(((((((....))))))).)).....))))).)))).))).)))))))....)).....}})....)))))).......))),,)))))..{,{{,.........,))},)}.))))))))....(((((((............))))))).....(((((.,((((,{({(((((((,((((((.{(.,{....}).}}..)))))).,)))}||.|||||,,{{{,....,,)))}),|||||,|||||........(((((((......))).))))......,)))))}))))|{((({,....})))),...,)))))})))),)},,)}))))))))),.....)))))))....))))))))))))..)))))))))..((((((((.((((((((((........))))))}..,))).)))))))).))))))),}))))))))){((((((.{....,,......,}}..}.))))))}.....((((.....{{.,,.....)).....)))).......................}))))))))))))))){(((.((((..,,(((((....)).))).,,)))).)))}....((((((((((((((((.(({({{......}))).)}))))))))))))))))...))).))))).))).).....(((((((.(((((((..((({{(((((..((((.(((....))))))).}}...||}|.,}}||,.}}}}).,(((((..(((((..........(((((....))))).(((((.....((((((.((((((((((((,(({(.{,,.((.,,{(({{(((({((,.,,..,,,,}))).,..,))))).,),.,)).,,,)}},.)))))))))))).)))))).....)))))(((((((.......)))))))})))).))))))).}))))))((((((((....{{(((((((...))))))).}}...((((((((....{(((((((.((....((((..((((...((((,..,((...,)))))))...))))..)))).....)).)))).))).)....)))))))).(((((....((((....(((((({({{...}}}}.)))))).....))))......((((({.......}))))).........))))).((((..((((.(((.{(((...)))).)))))))})))...............)))))))){(((((((......)))))))}....(((((((((.....))))))))),..)))))).)))))..))))..))))))))))...))))),|||{},,,,,}}}}..,{{{{....))))..(((((,{(((((((..((....((((.{........).)))))}.))))))))))))).((((({{.{(,,.....}}.)),)))))..........(((((....{{.(((((((....,,,.,..(((((((((((.(((((..,,,,,{,,,,,{{{({..{((,((((,,,,..,{{((((((({((((((((,....,}..})))))....,}|||,.,,{{{{{...,{,....,,))))}...,))))...))))}))).}}),},})}},)))}|{{{|,,...(((((((.,((((.......{((((.,,.((((..(((((....(((((((....((((((.,({.{(((.(((({{.{({{(((((((........)))))))...,.|||{{,,,,..}}|||{....}))},..)))).)))))..))))))...))))))).....)))))..)))),...}}))}{(((........)))},,.{((((({,{{{,{....,.,...,)).))))))}.,,..((({(((((((((....(((((((........))))...))).....)))))))))))).,,,,...{|||,{{{,.{(({.((((.....((((((.{(((((.....)))))).....{(((.(((.{{....}}.))).))))...(((((.((((...)))).))))))))))).....)))).,)))}})))}}.)))}{(((((.(((((((....))))))).)))))))))))))......})}}...{|{{,.,,.,)))),.,}),},....))))).))))))))))).{((((...((((((...((((((....))))))...)))))).))))}...,,,,,|((((..((.{((((((.((.,,.{.{{{((({(,{{{{,,.(((((((((....((.((((((({..,{,....,,,|,........{((((((((((((((((((({...,,,.(((.((((((((((((.{{.(((((((((((....,,{{..{{{{{((({{(,...........,,......((((({{,,,..{{,,{{{{{,,,..(((((((........)))))))...,,|,|,,,,,}}})),}}}}.(((((((((....(((((.....))))))))))))))))))))),})))))))}....(((((((((((((....(((((((.(((.((({.,.....(({..{,.....||{,|},....,|||},((((({{.....,}}}|{{|||,(((((...(((....}))...))))).||||}},,,,))),}))))..(((((((((((({{{{....,}}}},,,|....((((((.((((((,...,})))))).)))))).......))))))))))))....})).))},)))).....{(.(((.......)))}}......{(.((((((((((((((((.((........}}............)).)))))}.,)))))))))).)))))))))),,)))).))))))))))))}...))))))).))))).))).|||{{,,...,,,,,,||((((..(((...{(((.{{{,{{.((((.((((.((((...}))).)))))))),...,{{..(((((((..((((........)))).))))))),|||{...)}))))))}...}}}..}}}},,,....}))))))},)))).,,,}|||||||,,.||{{{{{{{|,|{.||,.,,||,,}}..}}.}}}))}}}}},,}|{||...,)))).{{{{(({..{((....))).)}))))),....})})))))))).||,,.||,..,{{,,..,||......},.{(((((........))))))}))))))).)).....)))))))))....(((.,,...}}),|||}|||{,...,,,..{{{{{..,......))}))}},....(((((......)))))((({((..{{{.,,,..,,},,,)}),}))))),|,,,.})))))))))).))))},{({{((((.....}))))},}||..(((((.(((.{......,.))).)))))..||,,....,,,,)))))))..}}...)))))))))))))))))))..)}|{{(((((..({((((.((.((.(((....))).)).)).)))}.,,))),.))}}}}},.,..........{{{{{{....,))))}...)))))))))....)))))))))))))))....,....,,{((((((.,,,,.{{({{,,....,))),),)))))))((((((((..........))))))))...,,......,....)))))).......})))).

Transcripts

ID Sequence Length GC content
CUCUCCAGGCAACCUAGUGCUGAUCGCUCGUGCCGGUGCGGCCGUUAAC… 6560 nt 0.4224
Summary

This gene encodes a member of the PPM family of serine/threonine-protein phosphatases. The encoded protein is localized to the nucleus and dephosphorylates and inactivates multiple substrates including serine/threonine-protein kinase PAK 1, 5'-AMP-activated protein kinase (AMPK) and the multifunctional calcium/calmodulin-dependent protein kinases. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, May 2012]

Forensic Context

A study in mice demonstrated that the PPM1E transcript, identified as a cancer-associated phosphatase, increased in abundance within 0.5 hours postmortem in brain tissue [Pozhitkov et al. DOI:10.1098/rsob.160267]. Furthermore, the PPM1E transcript was part of a seven-gene set in mouse brain that, when analyzed via linear regression, provided accurate postmortem interval (PMI) predictions with an R² of 0.95 and a slope of 0.87 between predicted and actual times [Hunter et al. DOI:10.1016/J.Forsciint.2017.02.027].