| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGGCCGGAAGGAGGCUGCCGGAGGGCGGGAGGCAGGAGCGGGCCAGGAG… | 1454 nt | 0.5915 | |
| AGGCCGGAAGGAGGCUGCCGGAGGGCGGGAGGCAGGAGCGGGCCAGGAG… | 1421 nt | 0.5890 | |
| AGGCCGGAAGGAGGCUGCCGGAGGGCGGGAGGCAGGAGCGGGCCAGGAG… | 1289 nt | 0.5896 |
The protein encoded by this gene is one of the three catalytic subunits of protein phosphatase 1 (PP1). This broadly expressed gene encodes the alpha subunit of the PP1 complex that associates with over 200 regulatory proteins to form holoenzymes which dephosphorylate their biological targets with high specificity. PP1 is a serine/threonine specific protein phosphatase known to be involved in the regulation of a variety of cellular processes, such as cell division, glycogen metabolism, muscle contractility, protein synthesis, and HIV-1 viral transcription. Increased PP1 activity has been observed in the end stage of heart failure. Studies suggest that PP1 is an important regulator of cardiac function and that PP1 deregulation is implicated in diabetes and multiple types of cancer. Three alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2020]
A study in humans analyzing the temporal gene expression response to burn injury using a factorial time-course microarray method (TANOVA) identified the PPP1CA as having a main effect related to age, being classified into a group of genes related only to age and not burn injury, where it is involved in the production of nitric oxide and reactive oxygen species in macrophages [Zhou et al. DOI:10.1073/pnas.1002757107]. In a separate study in porcine skin investigating bromine-induced burns, the PPP1CA was identified as a signaling component with significantly increased expression specifically in the 45-second exposure group at 7 days post-exposure, where it is part of the insulin receptor signaling pathway [Price et al. DOI:10.1016/j.toxlet.2008.08.007].