| ID | Sequence | Length | GC content |
|---|---|---|---|
| CUUCUCGUGGUUCCAGUGGGGAGAGAAGGAGGAAGUAGGGAGCGGGGUG… | 1521 nt | 0.4451 | |
| CUUCUCGUGGUUCCAGUGGGGAGAGAAGGAGGAAGUAGGGAGCGGGGUG… | 2552 nt | 0.4040 |
The protein encoded by this gene belongs to the protein phosphatase family, PP1 subfamily. PP1 is an ubiquitous serine/threonine phosphatase that regulates many cellular processes, including cell division. It is expressed in mammalian cells as three closely related isoforms, alpha, beta/delta and gamma, which have distinct localization patterns. This gene encodes the gamma isozyme. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
A study in humans analyzing peripheral blood transcriptomes from burn patients identified the PPP1CC as a key lactylation-related molecule with strong diagnostic potential, demonstrating an area under the curve (AUC) of 0.919 for distinguishing burn patients from controls [Li et al. DOI:10.3389/fmed.2025.1554791]. A separate time-series analysis in humans revealed that the PPP1CC exhibits a significantly decreasing expression trend from 0 to 7 days following severe burn injury [Wu et al. DOI:10.1016/j.burns.2018.08.022]. A study in mice demonstrated that the PPP1CC transcript, a cancer-associated phosphatase, exhibited increased abundance within the postmortem period [Pozhitkov et al. DOI:10.1098/rsob.160267].