| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCUCUUAUCGGUUCCCAUCCCAGUUGUUGAUCUUAUGCAAGACGCUGCA… | 2350 nt | 0.5902 |
This gene is a member of a group of genes whose transcript levels are increased following stressful growth arrest conditions and treatment with DNA-damaging agents. The induction of this gene by ionizing radiation occurs in certain cell lines regardless of p53 status, and its protein response is correlated with apoptosis following ionizing radiation. [provided by RefSeq, Jul 2008] CIViC Summary for PPP1R15A Gene
A study in humans demonstrated that the PPP1R15A gene, specifically the cSNPs rs626974 and rs500079, was incorporated into an 18-cSNP RNA typing system for individual identification from hair shafts, achieving a combined discrimination power of 0.999969 in a Shanxi population and 100% concordance with DNA typing results [Liu et al. DOI:10.1016/j.fsigen.2023.102929]. In a rat model of fatal hypothermia, the expression of the PPP1R15A mRNA (Ppp1r15a) was significantly increased in the iliopsoas muscle specifically in severe hypothermia compared to control and mild hypothermia groups, identifying it as a potential marker for hypothermia severity [Umehara et al. DOI:10.1007/s00414-018-1888-3].