Basic Information

Symbol
PPP1R15A
RNA class
mRNA
Alias
Protein Phosphatase 1 Regulatory Subunit 15A GADD34 Myeloid Differentiation Primary Response Protein MyD116 Homolog Protein Phosphatase 1, Regulatory (Inhibitor) Subunit 15A Growth Arrest And DNA Damage-Inducible Protein GADD34 Growth Arrest And DNA-Damage-Inducible 34 Protein Phosphatase 1, Regulatory Subunit 15A
Location (GRCh38)
Forensic tag(s)
Individual identification Cause of death analysis

MANE select

Transcript ID
NM_014330.5
Sequence length
2350.0 nt
GC content
0.5902

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-920.91 kcal/mol
Thermodynamic ensemble
Free energy: -957.67 kcal/mol
Frequency: 0.0000
Diversity: 508.62
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..(((...(((((......(((((((((.((((((((((((.((..((.((....)).)).))))))).((....)).(((.((((.(.(((.(...(((((((...))))))))))).))))).)))))))))).)))).))))).......)))))...))).((((((..(((((((((((.(((...))).....)))))(((((.((((...(((((((((...............(((((...))))).(((.(((.(((.(......).))).))).)))((...((((((((((((((.((((((((..((((((((((((((....(((...(((((...(((((((((.....)))).)))))....)))))...)))....(((..(((((((...)).))))).)))((.((((...((((((.....))))))..))))))....((((((((((....))))).))).)).)))))).......))))))))((.......))......))))))))..........(((((..((((...((((.((((((((....(((...........((((((.((((.((((((.(((..((..(((((.....))))).))..)))..)))))...).)))))))))))))...))).))))).))))....))))..)))))..((((((....)))))))))))).))))))))....))....)))))))))......(((.((((..........))))..)))....)))).)))))...(((((((..((........)).))))))).......((....))..))))))))))))..((((..(((((.((((((((((.((((.....(((((.(((((((.(((..(((..((((.(((............((((((((....................................)))))))))))))))........)))...)))))))))).)))))......)))).)))))......))))))))))))))(((((((..........((((((...((((.(((((((((((((((.....((((((((.(......).)))(((..(((..(((((((.(.......))))).)))...)))..))))))))....)))))).))))))))).....((((((((...((..((((((((((((...((...((((.((.(((((....))))))).))))....)).)))).))))))))..))...(((((((.(((((.....(.(((((.(((.((...(((.......((((....(((.....(((((((.(((((.((..(((((.((....((((((((......((((((.........))))))))))))))..)).)))))...)).)))))..((((..((((.(((((...(..((.((((((((......))))).))).))..)((((((((((......))))..((((((((((...((((..((((.((.(((..((((((((..((..((((..((((.......((((..((....((((((((......((...)).....))))))))...))..))))((((((...((((.(((.((((.((((.((((((.(((....((..(((((.....((.(((............))))).....)))))..)).......))).))))))...)))))))).)))..)).))))).)))...))))..)))).))...))))))))..).)))).))))...(((..((((((((...((((((...................((((.(((((......(((....(((((((((((((..(((((...)))))..)))).....))).))))))....)))))))))))).(((((..((((....)))).)))))(((((...))))))))..))))))))))).))).))))...)))))))))))))).)).)))))...))))..))))......(((((((((....))))))))).)))))))...))).))))......))))).))).)))))).....))))).)))))))))))))))))))...)))))).(((.(((((((..((.((((.....)))))).....(((((((.((((((.((((...)))).))...))))...)))))))))))))))))(((((....)))))(((((((.((((..................)))))))))))................)))))))........
Thermodynamic Ensemble Prediction
.{{({,,((({((({,.(((((((((((.((((((((((((.((..((.((....}).)).})))))},({...,)).(((.((((.{.(((.{...(((((({...}))))))}))).))))).)))))))))).))){,{{(||(((((,{..((.{,,((((((({({..(((((({(({{{{((....||||.,.}))))(((((,((({.{.(((((((((.,|,,|,........(((((...))))).(((.(((.((({(.....}}.})).))).))){,...((((((((((((((,((((((((..((((((((((((((....(((...(((((...(((((((((,...,)))).)))))....)))))...)))....(((..(((((({...}),})))).)))((.((((...((((((.....))))))..))))))...,({((((((((....))))),)}).)).)))))).......)))))))){|....,,.}},.....)))))))),,,.....}|({((({{({{{...{{{{.{{||||{{....{{,..........,{{{{{|.{|||.,||{||,|||..{|,,{||{|.....)))}),))..}}}..}}}}}...},)))))))))}|||,,,}}}.}}}}}.}))),...,))),.})))}..((((((....)))))))))))),)))))})).,,.}}..,.))))))))),{,.{{{(((((({.......,||))))}.}}|..,.})}}.))}}}..,(((((((..((.,,,.,}.)},))))}}},.....,{{.....,..}}})))))))))...,,,,..,,,,{(({,.{((((.((((.....(((((.{((((((.(((..(((..((((.(({.,..........((((((((....................................)))))))))))))))....,,,.)))...)))))))))).)))))......}))}.)))))}))}))))})),.,.))))),,{{|||.........,||||||,..||||.(((((((((((((((.....(((((,((,{.{{{..,.))){{{..(((..(((((((.(,,....,))))).)))...)))..))))))))....)))))))))))))))).....((((((((...((..((((((((((((...((...((((.((.(((((....))))))).))))....)).)))).))))))))..})...(((((((.{((((.....{.(((((.(((.{,..,{{,..,,{{{(.((.{(((({.{...(((((((.(((((,((,.(((((.((.,..((((((((,.....{(((((.{.....,.)))))))))))))).,)).))))),,,)).))))}..((((..((((.(((((...((.,{...{,(((({.{{..,,)),}))))).,.,|,|||((,,,.,,.,{||||..((((((((((.,,((((..((((.((.(((..((((((((..,{..((((..((((.......((((..((....((((((((...,..((...)).....))))))))...))..))))((({{{,,.((((.(((.(((({((((.((((((.(((..,.((..(((((.....((.(((............))))).....)))))..))...,...))).))))))...)))))))).)))..)).))})).)))...))))..)))).,}...))))))))..).))}),))))...(((..((((((((...((((((.,.................((((.(((((......(((....(((((((((((((..(((((...)))))..)))).....))),})))))....)))))))))))).(((((..((((....)))).)))))(((({...})))))))..))))))))))).))).)))).,,))))))))))))))})).)))))...))))..))))..,,,.(((((((((....))))))))).)))))))....,,.)))))..,)}.)))),))).))))),,....))))}.))))))))))))))))))).},)}}}}},(((.(((((((..{(.((((.....)))))}.....(((((((.((((((,((,{..,)))).}}...))))...))))))))))))))))){((((....))))}{(((((,,{{{{..,,...........,..}))))))))))......,,|,......}))))}),,,.....

Transcripts

ID Sequence Length GC content
GCUCUUAUCGGUUCCCAUCCCAGUUGUUGAUCUUAUGCAAGACGCUGCA… 2350 nt 0.5902
Summary

This gene is a member of a group of genes whose transcript levels are increased following stressful growth arrest conditions and treatment with DNA-damaging agents. The induction of this gene by ionizing radiation occurs in certain cell lines regardless of p53 status, and its protein response is correlated with apoptosis following ionizing radiation. [provided by RefSeq, Jul 2008] CIViC Summary for PPP1R15A Gene

Forensic Context

A study in humans demonstrated that the PPP1R15A gene, specifically the cSNPs rs626974 and rs500079, was incorporated into an 18-cSNP RNA typing system for individual identification from hair shafts, achieving a combined discrimination power of 0.999969 in a Shanxi population and 100% concordance with DNA typing results [Liu et al. DOI:10.1016/j.fsigen.2023.102929]. In a rat model of fatal hypothermia, the expression of the PPP1R15A mRNA (Ppp1r15a) was significantly increased in the iliopsoas muscle specifically in severe hypothermia compared to control and mild hypothermia groups, identifying it as a potential marker for hypothermia severity [Umehara et al. DOI:10.1007/s00414-018-1888-3].