Basic Information

Symbol
PPP1R3A
RNA class
mRNA
Alias
Protein Phosphatase 1 Regulatory Subunit 3A GM Glycogen-Associated Regulatory Subunit Of Protein Phosphatase-1 Protein Phosphatase 1, Regulatory (Inhibitor) Subunit 3A Protein Phosphatase Type-1 Glycogen Targeting Subunit Protein Phosphatase 1 Regulatory Subunit GM PPP1R3 PP1G RG1 Protein Phosphatase 1, Regulatory (Inhibitor) Subunit 3A (Glycogen And Sarcoplasmic Reticulum Binding Subunit, Skeletal Muscle) Type-1 Protein Phosphatase Skeletal Muscle Glycogen Targeting Subunit Glycogen And Sarcoplasmic Reticulum Binding Subunit, Skeletal Muscle Protein Phosphatase 1 Glycogen- Associated Regulatory Subunit Protein Phosphatase 1 Glycogen-Associated Regulatory Subunit Serine /Threonine Specific Protein Phosphatase Protein Phosphatase 1, Regulatory Subunit 3A
Location (GRCh38)
Forensic tag(s)
-

MANE select

Transcript ID
NM_002711.4
Sequence length
4328.0 nt
GC content
0.3678

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1007.10 kcal/mol
Thermodynamic ensemble
Free energy: -1101.63 kcal/mol
Frequency: 0.0000
Diversity: 1175.74
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((((((.((((...)).)).))))))..((((..((((..........((((((((((((((((.((((..(((.((((..((((((((((((.(((((....(((((((......((((((((((..(((...........((((((..((((((((((........((((((((.........)))))))).)))))))))).((((((.((((((((..(.(.((((((((..........))))..)))).).).)))))))).))))))..((((......))))....(((...(((((.(((.........))).)))))....)))((((((.(.(.(((((.(((((....)))))((((.(((....((((((.................))))))((.(((((....((((((.((.(((((.(.(((((((...(((((((...)))))))...)))))))..).)).))).)).))))))....))))).))((((((((...((((((.((((.((((..(((....)))))))...)))).))))))...))).)))))((((((....(((.((.((((((.(((((((((.....))))(((((((((...(((((((((.....)))))))))(((((((((...((((((.(((((...((((............)))).)))))))))))....((((..(((.((((((((.....((((((((......((((((((..............((((((..(((((..................((.((.(......).)).))......(((((......)))))........)))))................(((((((....)))))))(((((((((((((((.((((.(((..((((..(..((((.........))))..)..))))..)))............((((((.....))))))...................)))))))))))....((((((.......))))))...(((...))))))))))).....))))))....))))).)))........))))))))(.((((.((....)).)))).)..))).))))).)))...)))))))))))))...((((......))))..)))))))))..((((.....(((((((((.((((........))))..)))...)))))).....)))).....))))).)))))))).)))...))))))..(((((((((((...........))))).))))))..)))))))....((((((..........)))))).....)))))).).)))))).......((((((...................)))))).))))))...........))).))))))))))........)))))))....)))...)).)))))))))))).....((((.((.((((....)))).))...))))...))))))))))).))))))..)))))))))).))))...)))).((((((((((((.((((((((((((...((((((.............((((...)))).......((......))....((((((((((((((...........(((((((((.((((((((((((.((((((((..((((((..(((((((((.(((.......)))....(((....)))......))))))).))((((((((((((((...(((((.....(((((.(((((((.((((....(((((((((....(((((((((((.....(..(......)..).....)))))))))))((((((.((((((.(.......))))))).))))))........(((((.((.............(((((....(((((((...))))))).....)))))..........)).))))))))))))))................(((((((((((..............((.....))..((((((((((((.((((((...((((..(((((((((((......(((((((((((((((.......((..((((.((.(((((((((((.....((((((((........(((((((((.((.((((.(.((.(((.((..((.....(((((...(.((.........)).)...)))))...))..))))))).))))))).)))))))))..(((((...)))))...............))))))))..((((..(((((((.((((.............((((..((((((.((((((....((((((.....)))))).))))((((((...(((((((.....))).)))).))))))(((((((.....)))))))((((((.((((.......))))...))))))..(((((.(.((......)).).)))))........((((.....(((((...........)))))...))))..........)))))))).))))))))))))))).)))).........................(((((..(((((((..(..((((...))))..)..)))))))..)))))..........)))).)))))))..)).)))).))...............((((((......)))))).))))))................)))))))))........))).))))))))..)))).(((((((....))))))).........(((((....)))))(((((((..(((((((......))))).)).......)))))))((((((((((...............(((((((((((..((((((((.(((...........((((((((....((((((..............))))))......))).))))).....(((((.((((((......(((((((((((((.((...........)).))).)))))))...((((...(((((((..((((((........((((...(((.(((((((.(((.((.....((((...((((..(((...)))....))))....))))((((........))))..))))).))))))).))).))))..))))))..))))))).))))..))).....)))))).))))).............)))..)))))))))))).))))))))))))))..))).......((((..(((((((......)))).)))...))))))).))).)))))..)))))))..(((((((......)))))))........((((((.................))).)))..)))))))))))....)))))))).)))...)))))..)))))..)))))))))))))).........(((((.......((((......(((((((((......)))))..(((((.(((((....))))))))))............(((((.(((((((......(((.......)))......)))))))))))).))))......))))......))))).))))))....)))))))).....((((.((....))))))...)))))).)))))))))).))))).(((((........)))))..........((......))))))))))))))))..(((((((((((...............((((....))))........((((..(((((..((((((((.....))))))))..)))))..))))..(((((.(((((..(((.........)))..))))).))))).............)))))))))))..))))))...)))))))...(((((.........((((((.........)))))).........)))))...................((((((((((((.((((((((((((((........))....))))))....(((((.(((((((((((((...((((((((((((........((((.((((.(((......)))...((((((((....)))))))).((((...))))(((((....))))).)))).))))))))))))))))...........))))))).))...)))).)))))......)))))).))))))))...)))).....((((..((((((...(((....)))...))))))...))))....))))))))))...(((((((...))))))).)))))))...
Thermodynamic Ensemble Prediction
.((((((.((((...)).)).))))))..{{{(..{{,,.,,,.{,...((((((((((((((((.((((..,{(,(((({.((((((((((((.((,,{{{,.{((((({......(((((((((((.......{(((((...((((((((.(((((((((.,.....{(((((((.........)))))))|{{.((.((.{(((.(((((((((((((((((...((.{(({.(((((((((..((((((..((.(,{({..((((..{(,(((({..,{,{{{{{(({,{{((({.(((({(,(((,....,|,,|||.||||||,.{|}},..{{{{{{,,{(({,.(((((...,))))}......|}},..((((((.................)))))},..,||||,|,,{{((((,{{.{{{{{,{.(((((((...(((((({...})))))).,.)))))))..|,|}.}}}.}}.}}}}}}.{{{{{.|{{.(((((((((...((((((.((((.{(((,,{|,..,,})}}))}...)))).))))))...))).))))}},|}.,..}}))}.,,}||||||||,}||||||,,.,,),}}|{|{.......((((((((((.....))))))))))|||||,{{|...((((({((........}))).}}}}.,.}}),,,.}}}}}}}}}}},,,.,,,}}}}}}.,))))))}))))..)),.).))..)))))).))))))))).....,})}.}}.)))))))...)))),,)))))))))..)).))}}}....))))))))}.....(((((......)))))....)})).))))...,,...........(((((((....))))))){{{{{{(((((((({{((({.{{,..{(((..,..((((.........))))..}..)))}..,,.......{{{{{.((((((.....)))))).}},,,,........,...)))))))))))||,,((({{({,,....,}}}}}...{{|,,.,}},}}}}}}}.......{{{{{(({|,,,{,(({.{(({,..,,{{{{..,...}}))...}},}}).))},..,,,)))))),,,....,|((({,,(((((((,((((......)))).,)))}.)))).})))}.....{(((((,(({({(({.{{....)))),.,))}}.)))))}.)))))).......))))))))))).(((({,..{(((.,...((((({{{{{{...,,.,,,,.}))}).))))))..,{......|,.((((((..........))))))))))}))}..,|||{..{{{....,}}.,}))}((((((((...........{,.{{{...))}............))))))))).,,.........,}))))}}....}}},.,|}.)))))))))))}..,...,|,||||{,,|....,}))})},,.},,,...}})},}})))}.))))))}})))))))}}}.},)).,,)))}.(((((((,,,(((({,,((((((,({((((((((.............,,,....,|||,......{({,....,.....|,,,|||||{{(((,..,}},....,{{((((((,((((,((({(((,{(,,.{,,...|}||}}}||(((((((.(((.......)))....(((....)))......))))))).},((((((((((((((...(((((.....(((((.((,((((.({({....(((((((((....(((((((((((.....{..(.,,...,..,.....))))))))))),,((((.(((((({(.......))))))).)))}||{{.{{{{(,,,,,.,,}}}}}..,,}}..(((((.{{,(((((((...)))))))..,..)))))..........,,.})))}))))))))).......,,.....,,(((((((((((.{,,..........{{.....}}..((((((((((((.(((({{,..((((..(((((((((((...,..(((((((((((((((.......{{..((((.((.(((((((((((.....{(((((((...,,.,.(((((((((.((.((({,(.((.(((.((..((....,(((((...|,{{.......,,,}.....}))))...))..)))))}).))))))).)))))))))..(((({...})))).............,,)))))))|.,(({,..(((((((.((((.........,..,{{{|..((((((.((((((...,((({{{.....)))),}.))))|(((((...(((((((.....)))},))).))))),{((((((.....))))))),,,{{{.{{{{......{||||,||{{{{{,..((((,.,.,,......))}),)))))}}}},.,{({((.....(((((..,.....,..)))))...)))),.........,})))))).,,,,))))))))))).}}}}.,..............,}}}}....(((((..(((((((..(..((({...})))..)..)))))))..)))))..........)))).)))))))..)).)))).}}...,.........,.((((((......)))))).))))))},..............}}))))))).,..,...))),,)))))))..)))).(((((((....))))))).........(((((....)))))(((((((..(((((((......))))).)).......)))))))(({(((((({..............|(((((((((((..((((((((.(({.......,,,.((((((((,,..((((((....,.........))))))......))).)))))|},..(((((.((((((,{...,(({{(((((((({,(({,.,,......}}.}}}}}}}}}||,..((({...(((({{{..||{{{{...,,,,.||||...{{{.(((((((.(((.{,....,{,{{{.,((({..((,..,}})..,,}}},....,,|(((((........)))))},,))).))))))).))).)))),,))))}},,))))))}.)))}..})).....)))))).)))))............,))}..))))))))))))}}))))))))))))}.,))).......{(((..(((((((......))))}})).,.)))),}},))).)))))..))))))),.(((((((......))))))).}......{||{||,,.....,..,......},,.,}}.,)))))))))))....})),)))).)))...)))))..)))))..)))))))))))))).,,,|,{{{{{{,..{{{{{.||||,{||,,{|,,,,)}})))},,||,....{((((.(((({....}))))))))}....|||||,..(((((.(((((((......{{(,.,,,..}}},.,.,,)))))))))))).(((({.(((((({...{{{.{{,,...|||||..{{(|,,|||}...,}}}|}}}}.,.,}})))}..})))))).)))))..||||}}}}}.||||{...,,.{{|||,..........}}}}}...,))}}},,}}}}}},,},.|||((((({,...,}}}}}......,|{{{,{...,,....,,,,,|{||,,{||||,,((((((((.....)))))))).,)}}||,,||}}..{{{||,|||||..{{{.......,,)))..})))).}))}}..,}},.,}}}}}))}}}}}}},}..,,,}}},},.,.,.}||..,{{,,.,}}}}}}.|}}}}}}})}}...,|,||||,.....,,.,}}}}}},,...............((((((((((((.((((((((((((((.{....,.))....))))))....(((((.(((((((((((((,{.{(((((((((((,.....,,{(({.{{({,{{{,,,..,{{|..,((((((((....)))))))).|{||...}))}(((({....})))),}}},.}}}))))))))))))}.,,,.......,)))))).)),..}))).)))))......}))))).))))))))...)))).......{({..((((({{{.,{,,.{|||{....,)}))})..})}.)))))))),,))}..{{{((((...)))))}}.)))))))...

Transcripts

ID Sequence Length GC content
AUCAGAGAGCCCAAUGGAGCCUUCUGAAGUACCUAGUCAGAUUAGCAAA… 4328 nt 0.3678
Summary

The glycogen-associated form of protein phosphatase-1 (PP1) derived from skeletal muscle is a heterodimer composed of a 37-kD catalytic subunit and a 124-kD targeting and regulatory subunit. This gene encodes the regulatory subunit which binds to muscle glycogen with high affinity, thereby enhancing dephosphorylation of glycogen-bound substrates for PP1 such as glycogen synthase and glycogen phosphorylase kinase. [provided by RefSeq, Jul 2008]

Forensic Context

No relevant information is available at the moment.