Basic Information

Symbol
PPP1R9B
RNA class
mRNA
Alias
Protein Phosphatase 1 Regulatory Subunit 9B Neurabin-2 PPP1R6 SPINO Spn Protein Phosphatase 1, Regulatory Subunit 9B, Spinophilin Protein Phosphatase 1, Regulatory (Inhibitor) Subunit 9B Spinophilin Neurabin-II PPP1R9 Protein Phosphatase 1, Regulatory Subunit 9B
Location (GRCh38)
Forensic tag(s)
Tissue/body fluid identification

MANE select

Transcript ID
NM_032595.5
Sequence length
4212.0 nt
GC content
0.6384

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1932.30 kcal/mol
Thermodynamic ensemble
Free energy: -2001.61 kcal/mol
Frequency: 0.0000
Diversity: 1246.45
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((((......))))))..(((.((((.....((((((((((.........((((((((((((((((((.(((.((((.((((((((((((..((((..(((.....))).))))..(((((((...(((((((.(((.........))).)))))))................(((((..((((((((((((((...)))))))(((((((....((.((((..((....))..))))))....)))))))...))).))))....(((((((((((..(((((.......((((((...............)))))).((((((.((((.((..........((((((((.(.((...((((((((((((....)))...((((.(((((((((((((((((((((.((((...)))).))....(((((((.(((.....))))))))))))))))..((.((.....(((.((((..(((.((((((.((....(((((...)))))..)).)).)))))))..))))))).....)).))..((((.....)))).))))))))))))))))).))))))))))).))))))))))).)))).....((((.....))))(((.((((((((((..(((((.........)))))......)))))))))).)))...(((...((((((....)).))))..)))))))))..(((((((((.....))).)))))).(((((((....(((((...((((..((((((.....))))))))))))))))))))))(((((((((........)))))))))..))))).....)))))))))))..(((.(((((((....(((..((((.((.....))..))))..)))..))))))).))).)))))..))))))).))))))))).))).))))(((((((....)))))))))))))))))....)))))).)))))....((((..(((((.((((((((((((((((((((((((((((..(((..(((((((((((..........(((.((.(((((.((.(.(((((((...((((((((...))))....(((((.(.((....((.((((((((.((((..(((((..(((........)))..)))))......((((.(..(((((.(((((.((.(((...)))))..((.(((((......)).))).))((((.(.((((((((((....((((.(.(((....))).).)))).....(.(((.((((((((.........(((.....)))...)))))))).))).)..))))))).))).).)))).....))))).)))))..)...))))((((...))))((.(((.((((((.((((.(..(((((.(((((((.((((((((((((.((((......)))).))))).).....))))))(((.((.(((((..(((((((......((((..(.(((((.((.((.((((((((((((((((((...)))))).(((...(((.(((....))).)))....)))(((((.(((((((.((((((((((.(.....(((.(((.....))).)))).))))))))........((((.(((((((......)).))))))))))))))).))).)))))...)).))))))))))..)).)).))))))))))....))))))).))))).))..)))........(((((((.(.(((..((.(((.((((((((((((((.((....)).)))))..((((((((((((..(((((((.(((((((...((...(((((((....(((((.((((((....))...(((((..(.(((((.......))))).)..))))).)))).))))))))))))))....)))..)))).))))))).((((..(((((((((((((((((((..((((.(((((((((..((.((((((((((.(((....((((.((.(((.(((...((((((..((.(((((.((.((...)).)).))))).)))))))).....(((((((((((((...(((.....((((..((.((..((((((((((((((.((..((((((((..(((..((.....))..)))..)).))))))..))..)))((.((((.(((...))).))))))((((((........))))))..((.(((((..(((.(.(((((.(.....(((((..((.((.((((..((((.(.((((.(((((........((((((.(((.....(((..(((((.(((((......))))))))))((.(((((.(.(((((..((.((((.(.....).)))).)).)).))).).))))).)).......))).....))).))).)))......((((.((..(((((...((.(((((((((.....)))).)))......))))...)))))..))))))((((((.((((............))).).))))))((((.....((((((...((.(((....))).))....))))))...))))(((((........)))))...((((....))))..............))))))))).).)))).....))))))))..)))))).))))).).)))))))).))))))))).)))))))).))))........))).....)))))).(((.......)))...((.(((((.........))))).))...))))))).(((((((.((((((.(((.....))).)))))).)).)))))..(((((((.(((((.(((((((.(((((((((.(((...(((((.((((((.(.(((((.((((..((((((......))).)))...............)))).))))).).))))...)).)))))(((((.(((((((..........)))))))..))))).(((((...)))))))).))))).)))).))))))))).))).)).)))))....)))..))).))))))))))))))).)))).)).))))))))).))))......))))))).(((((((((((((((..((((((...((((((((.((((...(((..((.(((((..((((...))))..))))).))..)))((((((((...)))).))))..(((((((....))).)))).....))))...))))))).)....)))).....(((.((..(((((...))))))))))...(((((.(((((((((((((((((((((..((((((((((.((.((((.....(((((.((((.(((((.....((.......))....))))).))))...)))))((((((((...)))))....))).))))..)))))))))))).))))).)).))).(((.....)))))))))))))))))))......(((((((.((.(((((......(((.(.(((((((((...((...)).)))))))..))).)))......))))).)).)))))))...))..)))))))))))))))(((((((.((((.....(((.(((((............)).))).))).....)))))))))))(((((((.....)))))))))))(((.....))))))).))))..)))).........(((((...)))))...(((((..((((((((....))))))))...)))))..))).........))))))))))))))))))))).)))))))))))))...(((((.((((((...........))))))..))))).))))))).))))))))))))))))))).))....)))).)))))))).))......)).).)))))....))))...)))))....)).)))))))))))))...((((((((((...)))))...)))))))))))))).))..))).....).))))))))..)))))))...)))))))).)))))))))..))))..((((((..(((.((......)).)))..))))))....(((...((((((((((....))))))))))...)))...((.(((((........))))))))))).))))))...)))).)))......
Thermodynamic Ensemble Prediction
,(((((......)))))|,{((..(({{{.((((({(((({(|||.....,}||{{{{(((((({(((((,({((((((,((((((((((((,,,,.,{{((({,((,|{|,(({({,({(((((((({(((,(({,,,...}}}...))).)))))))}{,,,,{{{{{..{,{(((((({{({((((((((({({..|||,|||(((((((....((.((((..((....))..))))))....)))))))...,))||||}..}}.|||||||||,.,|,(((.{||...})}))),.............}))))))..{|||{.{{{|,||.........,((((((((.{(((...{(((((((((((....)))...(((((((((((((((((({((((,((((,,,,.{(((({||{,.,(((((((.(((.....))))))))))|||||,..)))|,..{{.,..}||||}},.({(({,,,,|}}}..(((((...))))){.((((((((((,.,.}}}))))))}).}...))))),},}})).)),)}))))))))))))))))).)))))))))))|,))))))))},,||}}..,{,((((.....))))||{,|{||{{|{|{.||||||{.,..,,.,}}}))||}||,}}))))))}}.))}.|,{||||.((((((....)).))))..))}))}})}}}|||||{|||,,,,,))).))}))}.(((((((,...(((((,..{((({.,(((((.....))))))))))))))))))))))(((((((((........))))))))),|))|}||.,,|||||||||||,..}|}.))})})).}}}}|,.,||||,|}..,,,}..|)))),,))}..|||||,,.|||{,,....))))}})),))))))))),))),))))|||((((....))))))))))}}}}}}|...,||||}}.})))),,,.((((..(((((.(((((((((((((((((((((((((((({.(((..(((((((((((..........(((.((.(((((.((.,.{,(((((.,,(({(((((...|}|},,||(((({,{.,,{{{,(({(({(({{{.{{{{..{{|||,,{||,,....,,}}},.})}}}....,,||{|||..(((((.(((({.((.(((...)))))..({.(((((......)).))),||((((...{|||||||{,....((((.(.(((....))).).))))....,{.|||,((((((((,,.......(((.....}}}...)))))))).})).}.}})))})}.}}},|,)})).....})))).))))).,}...))})((((...))))((.(((.((((((.((((.(..(((((.(((((((,((((((((((((.((((......)))).))))).}.....)))))){((,({,({(({..{((((({.,|,.,({((,,,.{{{{|,||.||.((((((((((((((((((...)))))).{{(...(((.(((....))).)))....))}(((((.(((((((.((((((((((.(,....(((.(((.....))).)))).)))))))},,,.,.,,((((.{((((((......)).))))))))))))))).))).)))))...)).)))))))))),,||,|}.}}||||}|||,|..}|}}}}}.|||||,||,.,,|,.,,,}}}|||{{{{.{,|||,{,,.{||.((((((((((((((.((....)).)))))..((((((((({({,.(((((((.((({(((,..((...(((((((....(((((.((((((....))...(((((..{.(({||.......|||||.}..))))).)))).))))))))))))))..,.)))..}))).))))))).(((((((({((((((((((((((((..((((.(((((((((..((.((((((((((.({{....{{((,((.(((,,.,...{(({({..,{.{{{{{.{(.{(,.{||{||.|||||{|||}||||..,,.,((({{{,,|||,.||,,|}},.}||.|}}}}.({{{({.,(((((,,,,,}||},((((((((..(((..((.....))..)))..)).))))))..}}..)))|,,((((.(((.,,}}}.}}})},((((((........))))))....{(((((({.(({(..((((.,.,((.((((((.{..((.(.((((((.({{,.((({,(((({......(((({((.(((,....{((,.(((((.(((((......))))))))))({.((((({(.(((((..((.((((.(,....),)))).)).)).)))|),}}))}.|)},.....)))...,,))}.}}))})}......({{{.((..{{{{,,,,{{|,,{((((((.....))))},||{,.{{{|}||,{.|||}}..)))}))||,|||}|{||,...,,,{,.,.}||.|.}})))){(((.....((((((...((.(((....))).))....))))))..,))),,{{|{.......,)))))...||||,,..)))}..............}}},)}}))})}))))}}}}.,)}))))).}))),,,,||,,{{{{{,,....,...))))),,))))).))))))))})))}}}}}}))})))).,)))),,,.))))))))}.},,,.|||||},......,||||}.},...),}))))}(((((((.((((((.(((.....))).)))))).))}}))))..,||||||,(({{{.(((((((.(((((((((.(((.,,((({{.{(((((.,.(({{{.,{{{..||((((......))))}))...........,,,,))}}.}}}}}.},)}))|,.,|,|||||(((({.{{||||{,....,....)))))))..})})),{((((...)))))))).)))))))))).)))))))}).,,},||,.,,.....)))))}))),))))))))))))))).)))).)).))))))))).))))......))))))).(((((((((((((((..((((({.,,,(((((((.((((...{{{..,,.(((((..((((...))))..))))).||{.||||{||(((((.....,.))))).(((((((....))).)))).....))))...)))))))}),}.,,|||.....(((.((..(((((...)))})))))}.|.(((((.((((((((((({{({((((((..{(((((((((.((.({((....,(((((.((({.{(((({{..{({,,.....})..,.)))}},)}}|,,{|}}))}{,(((((,..))))).,,}),,.)))}..)))))))))))).))))).})}})}.{{|.....)))))))))))))))))))......(((((((.((.(((((...,,.(((.(.(((((((((...((...)).)))))))..))}.))),}....))))).)).)))))))...))..)))))))))))))))((((((((((((.....(((.(((,({...........)).))).))).....)))))))))))(((((((.....))))))))))){((.....))})))).)))))})))}.........{{{{,...,||||...(((((..((((((((....))))))))...)))))...}},,.}}}...)))))))))))))))))))))}),))))))))))}...{((((.((((((........,..))))))..)))))}))))))).)))))}))))))))))))).))....}}}).)})))))).}}.,....,},},))))).}}})))))..))))).,.,,,.)).)))))}))}}...((((((({{{...)))}),..)))))))))))))).))..)))...}}).))))))))..)))))))...))))))))}}))))))))..))))..((((((..(((.((......)).)))..))))))....{{{...((((((((((....))))))))))...||,....,.,})||||.}|}}}}}}}.,}))}}}))))),))))),}))),,)}}}.

Transcripts

ID Sequence Length GC content
AAGCGGGAUUAACUGUUUUUGGCAGCUUGGUUUUGGGGGGACCCUAAAA… 4212 nt 0.6384
Summary

This gene encodes a scaffold protein that functions as a regulatory subunit of protein phosphatase 1a. Expression of this gene is particularly high in dendritic spines, suggesting that the encoded protein may play a role in receiving signals from the central nervous system. The encoded protein has putative tumor suppressor function and decreased expression has been observed in tumors. [provided by RefSeq, Feb 2014]

Forensic Context

A study in human samples identified the PPP1R9B as a candidate marker for nasal mucosa but discarded it from the final multiplex due to cross-reactivity observed in blood and menstrual secretion samples [van den Berge et al. DOI:10.1016/j.fsigen.2015.10.011]. A study in mice demonstrated that following clodronate pre-treatment and controlled cortical impact brain injury, monocytes exhibited a transcriptional shift, including reduced expression of the PPP1R9B which is associated with a non-classical monocyte identity, correlating with a neuroprotective phenotype characterized by reduced cortical pro-inflammatory cytokines, improved blood-brain barrier integrity, and smaller lesion volumes [Gudenschwager Basso et al. DOI:10.1186/s12974-024-03032-8].