Basic Information

Symbol
PPP2R1A
RNA class
mRNA
Alias
Protein Phosphatase 2 Scaffold Subunit Aalpha Serine/Threonine-Protein Phosphatase 2A 65 KDa Regulatory Subunit A Alpha Isoform PP2A-Aalpha PR65A PP2AA Protein Phosphatase 2 (Formerly 2A), Regulatory Subunit A (PR 65), Alpha Isoform Protein Phosphatase 2A, Regulatory Subunit A, Alpha Isoform Protein Phosphatase 2A Structural Subunit A, Alpha Isoform Protein Phosphatase 2, Regulatory Subunit A, Alpha Protein Phosphatase 2, 65kDa Regulatory Subunit A Medium Tumor Antigen-Associated 61 KDA Protein Medium Tumor Antigen-Associated 61 KDa Protein Testicular Secretory Protein Li 1 PP2A Subunit A Isoform PR65-Alpha PP2A Subunit A Isoform R1-Alpha PP2AAALPHA MRD36 PP2Aa HJS2
Location (GRCh38)
Forensic tag(s)
Postmortem interval inference

MANE select

Transcript ID
NM_014225.6
Sequence length
5352.0 nt
GC content
0.5357

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-2073.70 kcal/mol
Thermodynamic ensemble
Free energy: -2170.12 kcal/mol
Frequency: 0.0000
Diversity: 1373.58
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
....((((((((((.((((((((..((((((((.(.(((((((.(((((.((.((...(((((((....)))))))...))...((((.(.((......)).).))))..(((((.((........)))))))(((((........))))))).)))))((....)).(((.(((((.....))))).))))).)))))).))))))))..))))...(((((.......)))))((((((((((((....((((((..(((((((...((((((((.....(((((((((((.(((.((.(.(((((((((((..((((((((...((((((....))))))......))))))))..)).).)))))))).))).)))..))))).)))))).((.((((..(((((((.....))))).)).....)))))).)))))))).((((((((((.((.((.....)).)).)))))....)))))((((((((((...(((((.((..(((((((((.(((((((((((((((......)))).))))))))...))).(((((.((((((.(((.((((((((((((((....)))))....)))...)))))).))).((((.(((...((((((((.....(((........))).....))).)))))...))))))).))))).).))))))))))).).))..)).))))).)))))).)))).........)))))))))))))))))))))))))((....)).((((.....)))))))))))))..))))).((.((((.(((((((((((.(((((...))))).)))...((((((((((((..(((.(((..((((((..((.((.........)).))))))))))).)))....((((..((..((.((((..((((........)))))))).))..))..))))....))))))))))))...(((((.((.....)).))))).......((((((....(.((((((.(((((((...(.(((((.((((..((((..(((.....((((((...((((.(((((((((......((((((.(((((..(((((((((((..........((..(((.(((((.......((((((.((((((..((((((.(((((....)))))((((..((.(((.((((.(((......).))...((((((((((((((.((((((((((((((((((...((((((.......).))))).))))).....((((...((.(((.(((....((((....)).))...)))))).)))))).)))))))))(((((.((((((((....))).))))).)))))..(.((((((((((.((((((((((((....)))..))))))))).)).((((.(((...........))).))))...(.((((((...((.(((((....))).)).))...)))))).)...)))))))).)((.....)).....(((((.(((((.(((....(((....((((....)))).....))))))))))))))))......((.(((.((.(((((.(((...))).....))))))))))))..)))).)))))))(((((.....(((.((((..((((.......))))..)))))))..))))).....))))))).))))))).))..)))))))))).....)))))).)))))).))))).)))..)).......)))))))))))((((...(((......)))....))))..((((........))))......((((((.(((((((.(((.....((((((...(((((((...)))).)))..))))))(((((.(((.....(((((.((((.(((..........((((((((((((((((.((((((((((((((((((((((((((.(..(.(.....).)..).))))...))))).))))))..(((((((((.((((((((((((((.((((....((((...))))((.((((((.......)))))).)).)))))))))))))..))))).....((((((((.........)))).))))....(((((((.(((((((((((...((((((....((((((.(((((((((((((......(((((..(((((..(((((............)))))..)))))..))))).....))))(((((..((..(((.....))).)).)))))(((((((((((.(((((.((..(((.....((((((....))))))...........((((((....((((((......(((..((..((((((((((....))))).)))))))..))).....))))))..)))))))))..))))))))))))))))))......))))))..))).))))))....)))))).....)))))))....((((((((...(((((.((((.....)))).)))))......((((((..(((((.((....)))))))))))))(((((((.........)))))))((((((.(((((((((((........))))).))))))..))))))..(((((((.(((((((.(((.(((......))).)))....((((((....(((((...)))))..))))))...((((((((((((...(((((..((((((.((((.((.((((.((((((..(((.((.((((...)))).))..)))..))).......))))))).)))))).).)))))....)))))(((.((((((((..(((.((.(((((.((((((((((((....(((.((((((((((((..((((((..(.((((.(((......))))))))..))))))................((((((.((....)).))))))...((((((.((((((((((((..(((.......(.(((.(((.(.((((((..((((((((((((((...))))..((((((((((.((........))))))))))))(((.((..(((((........)))))..)).))).))))))))))....(((((........(((((((.......)))))))....(((((((...............)))))))))))).((((......)))))))))).).)))))).)))).))))))....))))))))))))...(((.((((((((((.(((((....)))))..)))))))))).))).))))))((((((.....)).)))))))))).)))....))))....))))))))..)))))((((((.(((((((.((((((((((((.(((....)))))))))......(((((.(((.(((.(((((((..((((((.....((((....)))).))))))...))))))).)).).)))))))))))))).))))))).)))))).((((((.(((((((((((((.(.(......)).)))))))......))..)))).)))))))).)))...))))))))))).(((........))).....(((((....))))).((((((((.((((((((.((....)).)))))))).)).....))))))..(((((((((((((((((.......))))))))))))))))))))))).))))))((..((.((.......))))..))))))))))))))))..))))))))((((((.(.((((..((((((.((.((..(((......)))..))))...)))))))))).))))))).......(((((((....(((((....))))))).))))).(((..(.((((((.(((((((..(((...(((.((((((((((((.(((((((((..((((((((((((.(((.((.(.(((((.......))))).)))))).))(((((..((..(((((.(((((((((...((((((((.((((.(((((((((((((......))))))..((((......))))........(((((.((((..(((((((..((((.(..((((((....))))))..((((((((((..(((((.......))))).))))).)))))...((((((((.(((((......))))).(((((....))))).......((....(((((((....)))))))....))(((((..((((((((((.(((.....((((...((((((....)))))).))))...))).)))).)))))).)))))...(((((((.....)))))))...((.((((.((.((...((((.((((((...((((((((...((.(((((.(........).))))).))..)))))))))))))))))).)).)).)))).))...))))))))).)))))))))))..)))).))...)))..)))).....))).))))..))))))))))))))))))))))..)).(((.....))).))))).))))).....)))))....)))))..)))).)))))))..(((((((......))))))).....(((((((...((..(((((.........((((....))))..))))).)))))).))).((((((.(((((((((....)).))))))))))))).))))).))).)))..)).))))).)))))).)..)))..((((((((..((.(...(((((((((((.((.......)).)...)))))))))).)))))))))))...))))..)))))))....)))))))))))))).))))))..((.(((.(.((......)).).))).))......))))).))))))).)))).(.((((((((((......))))).))))).)...(((((....)))))(((((((((......))))))))).......)))))))...)))))))))))))))).))).)))).)))))))))))...)))))).((((((.......((((((........))))))................((((((((...((((.....))))......)))))))).))))))))))))))).)).))...))))))...)))..))))..))..((((((.(((((...))))))))))))).))))))..)))).))).)))))))...)))))).................(((..((.((.....)).))..)))............)))))))).)))).))...
Thermodynamic Ensemble Prediction
....((((((((({,((((((((..((((((((.(.(((((((.{{{((,((.((..,(((((({....})))))).,,}},,.((((.(.((......)).).))))..{((((.((........))))))}{((((........))))),,.|||}}},,,)))},(((.(((((.....))))).))),}.)))))).))))))))..)))),..(((((.......)))))((((((((((((....((((((..(((((((....(((((,,....,(((((((((((.(((.((.(.(((((((({(({,((((((((...((((((....))))))......))))))))}})}.}.}))))))).})).)))..))))).)))))).||.((({.,{{(({((...,.|}}||{||,....)))}||||}}|,,}},{||{(({(((,((.((...,.}}.)),))))).||,}})}},(({((((((...(((((.((..(((((((((.(((((((((((((((......)))),})))))))...))}.(((((.,(((((.{((.((((({,{{{|{((.{|||}}},)}}|)),..,)))))).))}.(((,|(((...(((({{((,....{((......,,}}}..,..}}).)}))),..))))))).))))).}.))))))))))).).))..)).))))).)))))),)))))))}.....)))))))))))))))))))))))))({.,,,,}.{{{{..,,}},),)))))))))..))))).{(.((((.(((((((({,(,((({{..,))))){({|{{{((((((((((((..{{{.(({..|(((((.|.{.{{.........},.},))))))})).}}},,(.,(((..((..{{.{(({{,((({..,,,...))))})}).)),.))..}}))}...))))))))))),...{{{|{.{,,,,},}}.||||}..{|...,|||,|},,.{.((((((.(((((((...{.(((((.({((..((((..(((.....((((((...((((.(((((((((......((((((.(((((.{(((((((((((..........((.,(({.{{{{{...,,..((((((.((((((..((((((.(((((....)))))((((..((.(((.((((.{{{,.,.,.,.,,...|{||||{{((((((.((({((((((((((((((,..((((((.......).))))).))}}}.}},}||{,.,}}|}}||,|}{|||{((((.,,,||,||.,.,|||,|,||,)))|}}}})))))(((((.{(((((((....)))}}}))}.))))),.{,{{{(((((((.((((((((({{{....}})..))))))))).)),((((.(((...........))).))))...|,{(((((...((.(((((....))).)}.)).,.)))))|,|{||||||||||.|((,,.{{,,.....(((((.(((((.(((....(((....((((....)))).,...))))))))))))))))......,,.,,.{((.{{{||},,,...))),,}}.)))))))))))),,)))).))))))){{{{|...,.{((.((((..(((({....,.})))..)))))))..)))))....|||}},))}))))))).))..)))))))))).....)))))).)))))).})))).)))..}).......)))))))))))|{((,,.{{(,.,,,.||},,..}}},,,,||{,,,,..,,))),......((((((.(((((((.(((.,,..((((((...{((((({...)))),}}}..))))))(((,{{(((,..,.(((((.{{((.{((..,,,,..,.((((((((((((((((.((((((((((((((((((((((((((.(.{(.{.....).,,,,.)))),..})))).))))))..(((((((((.(((((((((((((,,((((,,..({{,...))))((.((((((.......)))))).)).)))))))))))))..))))),....{{{{((((..,,,,,,,||||||,}|,,{.(((((((,(((((((((((...((((((....((((((.((((((((((({{...,,,(((({..(((((.,(((((............)}))),,)))))..}}))),,}}.}}}|((((((({,,.........))),)))))|.((((((((((((((((({,((,,((,.....((((((....))))))....}}}....((((((.,..((((((...{.,({{..((..((((((((((....)))))}}))))))..,)).,...))))))..)))))),))..))))))))))))))))))).,.,}))))))..))).))))))....)))))).....)))))))....{{({((({{{,(((({.((((.....)))).})))).....,||{|||.,{(({|,{,....||||||||||}}|{((((({.{{.,,,|.}}}}||}(((({{.{{||||{||{{...,,,,.))))),)}))}),,))})))|.|||{|||,||{||||.(((.(((......))).)))...,((((((....(((({...}))))..)))))}.,.,{((({(({(((.{,(((({..{(((((,{((..((,((((.({((({..(((,({.((((,..|||}.}|,,||}..}}|,|...,,))))))).}})))).),)})}},,},)}))).||||||,{{{{.||{||||}|{{{{.,,||||||||||.}}.|||.|||||||||{{{..,({(((..{{{(((.{{{,.,,,.|||}|||,,.||}}}}|||{{{,{(({{{{..||{|||,||,||,}}.,,||||{{{(((({({((({({,,((((.,((,...,,,.,,||..{((,(,({((,...||{|||||{(((({,.,|}}},.,(((((({({.,...,,,,,}})}}}})}|}||(((.((..(((((........))))).,)).))),,)))))}}||{,{{({({{.{{,,...{{,||||,|||.,.}})))},....(((((((.{............,))))))).,,,,.((((......)))),}}}))})}))}}))}}))),})}}},..,|}||||},}})))||||{{.((((((((((.(((((....)))))..)))))))))),,)},)),)))||||||}},..||,||||||,},|,||}||,.|||},...}}}}}|||||}}}}}|}}}||,{((({{({({{(((((,{{(,{((,..,)}}))))||,,|,.,{((((.(({.(((.{(((((({..(((((.....((((....)))).))))))},.}))))}).)).).))))))))}},,)},)}|,||{{{{,{((((.((((.(((((((((((((.(.{......}).)))))))......))..)))).))))))))})))},.}}||}}}}}}}.}}}),,}.,,}}}}},,..(((((....))))),((((((((.((((((((.{{....}}.)))))))).)).....)))))),}(((((((((((((((({,{....})))))))))))))))))||||||{||||||{,.,,,|||.}},,,})))}}}||}}}}}}|}}}|||}.|||||||}}{(((((,(,(({(,,((({{{.||,||..{|||,,,.|}}),,|}||..,}}}}||}}}}.}}}|}}}.......{{{{{||,,,||||||....))))))).))))}.|||..{,||||||.{||||{|.,|||,..{{{.|||||(((((((.(((((((((..((((((((((,(,{{{.{.,(,(((((,{,,,|,|||}}.|||||}.},,{|||..|{..(((((.(((((((((,..{(((((((.((((.(((((.,{{||{{....,{|||||,...,(({{.{{{||||.{..{,...||,|}|}|}}}((((({({.(((,{{{{({{{((.,,,|||}},..{((({(((((,.(((((.,....,))))).))))).))))}(((((((,.(,((((.....}))).)))))))},((((((((.(((,,(({...})))))).)))).)))}},{{{{,..(((((..((((((((((.(((.,,..((((...((((((....)))))).)))).,.))).)))).)))))).)))))...{((((((,...,))))))))))),.((((.((.((...((((.((((((...((((((((.{{((.{((((.(........).)))))}))..)))))))))))))))))).)).)).)))).})}}})),)})))}}})))}))))))}))))))),..))))....)))}}},))).))))..)))))))))))))))))))))),,))}{||,,,,.},),))))).))))).....)))})}}..)))))..)))).)))))))..(((((((......))))))),,,,,.,|||{|,|,|||.{|||{|,|,,..,,((({....})))..))))},),))))||||,((((({,(((((((((....)).))))))))))))).))))),))).))).,)),))))),)})))),),,)),..((((((((..((.{...((((((((((..((.,.....),,}...)))))))))),))}))))))))...,,,}..|||||}}.},,)))))))))))))).)))))){,(({((,.{.,.....,}))|}||}}.||....}}))))).))))))).)))).|,((((((((((......))))).))))).)...,{{{,....,}}},(((((((((......))))))))).,,...,|||}}))...)))))))))))),))).))).)))).)))))))))))...)))))).((((((.....,.((((((........))))))................((((((((,,.((((.....)))),,....)))))))).))))))))))))))).)).))...))))))...)))..))))..)).,((((((.(((((...))))))))))))).))))))..)))).))).))))))....,,,|||.............,,,,,}|}}}})))}....,,..{{{({.......))))}.)))))))).)))).}}...

Transcripts

ID Sequence Length GC content
GUGCACGUCACUGGGACAUAACUUUUUGAGGCUGCUAUUCAGCCUCCUG… 5728 nt 0.5260
AGCACAGCGCUGGCCGCAGUCUGACAGGAAAGGGACGGAGCCAAGAUGG… 5352 nt 0.5357
Summary

This gene encodes a constant regulatory subunit of protein phosphatase 2. Protein phosphatase 2 is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The constant regulatory subunit A serves as a scaffolding molecule to coordinate the assembly of the catalytic subunit and a variable regulatory B subunit. This gene encodes an alpha isoform of the constant regulatory subunit A. Alternatively spliced transcript variants have been described. [provided by RefSeq, Apr 2010] CIViC Summary for PPP2R1A Gene

Forensic Context

A study in zebrafish and mouse demonstrated that the PPP2R1A transcript, a protein phosphatase 2 regulatory subunit A involved in embryonic epidermal development and cancer, showed increased abundance within 1 hour postmortem in mouse tissues [Pozhitkov et al. DOI:10.1098/rsob.160267].