Basic Information

Symbol
PPP3R1
RNA class
mRNA
Alias
Protein Phosphatase 3 Regulatory Subunit B, Alpha CNB CALNB1 CNB1 Protein Phosphatase 2B Regulatory Subunit B Alpha Protein Phosphatase 2B Regulatory Subunit 1 Calcineurin B, Type I (19kDa) Calcineurin Subunit B Type 1 Protein Phosphatase 3 (Formerly 2B), Regulatory Subunit B (19kD), Alpha Isoform (Calcineurin B, Type I) Protein Phosphatase 3 (Formerly 2B), Regulatory Subunit B, 19kDa, Alpha Isoform (Calcineurin B, Type I) Protein Phosphatase 3 (Formerly 2B), Regulatory Subunit B, Alpha Isoform Protein Phosphatase 3 Regulatory Subunit B Alpha Isoform 1 Protein Phosphatase 3, Regulatory Subunit B, Alpha CNA2
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses

MANE select

Transcript ID
NM_000945.4
Sequence length
3024.0 nt
GC content
0.4067

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-848.90 kcal/mol
Thermodynamic ensemble
Free energy: -908.88 kcal/mol
Frequency: 0.0000
Diversity: 733.46
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.........((((((((.(..((((..((((..((.((((.....)))).))..))))....))))..).))))))))..((((((((..(((.......)))..............((((((.(((...(((((((((.(((..((.((((((....((((((((..(((((((........))........................((.(((......))).))......).))))..))))))))....)))))).))....(((.((((((((((((((.(.((((.(((((((...((..(((....(((((..(((.((((........((((..(......)..)))).........)).))..)))..)))))..)))..))...))))).)).....))))...).)))...((((((.....(((.(((....)))))).....)))))).......(((((((((((((((...((((((...((...(((.((((((.((((((((.(((.(((((.((((.((((((.....))).....))))))).)))..(((..((.(((...((((((....(.((((...((....(((((((((((...((((((((((((.((((((((((((..(((((.(((((....(((((.((((((((........)))))..))).))))).))))))))))..))).)))....(((((....)))))..((((........))))(((.(((((((((.((.((((((...............(((((((((((((((.............((((((......(((((((((............((((((..(.....(((((..(((((..((.((((((((.........))))...)))).))((((((....)))))).)))))))))).....)..)))))))))))))))....)))))).....((.((((..(((((.......)))))....)))).))(((((((((((((....))))...(((((((.(((((.(((((..........(.((((((((............)))))))).).(((((((((((...(((.(((((((((((............((((....))))..((.(((((((((((((((.((..............((((((.............))))))(((((((((((((.((((....)))).)))))))))))))((((((....)))))).((((.(((((((....))))))).)))).........................((((....))))((((((((((((...((((...(((((((((.((((((((.(((((.(((((........))))).......(((.(((((..((((.((((((........((((((((...((((((((.((..((((((((...))))))))..))................(((((....)))))))))))))................((((((((((((....(((((((..(((((((..((.(((...............))).)).)))))))......((((((...((....))...))))))))))))))))))))).))))...))))))))...))))))))))))))).))).((((((((.(((..((....((((((...)))))).((((((..(..((..(.(((..(((((........))))).))))..))..)..))))))((((((....)))))).(((.(((((((.(.(........).)))))))))))))..))).))))))))..((((((((...(((((((.(((((((((((((((((..((((((....))))))...))))))).....(((.(((.....))).)))......(((((((((((..........((((((((.(.(((((..............(((((((((.(((((..((..(((.(((((..(((.........)))..))))).)))...))...))))).)))))..))))..............))))).)))))))))))))))))))).......)))))))))).))))))).)))))))).....))))).)))))))).)))))))))))))...))))))...))))))..)).)))))))))).))))).))...((((.(((((((((((........)))))))))))...))))(((....)))(((((.(((((((.....))))))).(((((((....))))))))))))..(((((((.......(((((..(((((.....)))))...))))))))))))...)))).))))))))))))))))))))).))))))))))))).)).)))))))))))...((((((((((.(.(.((((.(((.....))).)))).).).)))))........)))))..)))))))))..))))))..............(((((((.((((...)))).)))))))...)))))).))....))))))))))))......((((((((.((((.(((.(((((((((.........)))).(((((((((((((...)))).))))..))))))))))))).))))))))))))...)))))).)))))))))))).....((((((((((((.........)))))))))))))))))))))))..)))))))))))))..))).))..)))....((((((((....)))))))))).))))))))))).))))))...)))...))..))))))...)))))))))))))))))))))))))).)))..))).)))))).))).((((..(....(((((...((((.(.((((((....)))))).).))))...)))))...)..))))......))).))))))...........))))))))
Thermodynamic Ensemble Prediction
.....{((((((((.((.((((.((,.((((..((.((((.....)))).))..))))..((((((({((..(((((...((((......(((,{....,)}}...........................{{.......}}..))))..))))).}}}}.,)))))).,,,)).)))}.}).))))))))}........(((((.((((((((((((({.,(((.((({..{{{,..,(((((((,(((....{.(((({{({.............,)|))))),,..}}}})}||||,...||,}|||}||.(((((,,(((.({{{..,.....,|||.,|,,}}..|||||||........,||,}|..||}.,}},}),.)}}}||}...}}}}).))....,))),...}.)))...{{{(((..,,}|{|||||,,,,}}},}}.,.,.}}}}}}.,..,,,(((((((((((((((...((((({...((...(((.((((((.((((((((.(((.(((((,({{{.{{{|||,....|}}..,,,.}})}}}.}|,..(((..((.(((...((((((..,,{.(({{...{{,|..(((((((((((...((((((((((((.((((((((((((..(((({.(((((....(((({.((((((((........)))))}.})).))))).))))))))))..))).)))....,((((....})))}.,((((........))))|((.(((((((((.((.((((((........,{,,,..(((((((((((((((.............{(((({..{((((((((.(((((.......,,,{..{{..{{((,(,{,,{.,,{{,||),)),)..,|}})}||,,{.,(((((({..,.{.{{({{{{{.,,,})})}))))))),}.,,,,,,,.))))).))))))))))),..,||||||.,,,,((.((((..{((((,..,,,,}}}}}....)))).}}{((((((((((((....))),...,{(((((.(((((.(((((..........{.((((((((............)))))))).}.(((((((((((...(((.(((((((((((.,{{{,.......,,,.,,.,)))..{(.(((((((((((((((.((,,,,,...,,,,,,(((((,.,,,.........,}))}}{((((((((((((.((((....)))).))))))))))))},{{((({{..||||,,,,|||}{||||||,,..,,,,}},.,,}}.,,}},..}}},,......,,,,}}{{{{..,,))))((((((((((((.,.((((...(((((((((.((((((((.(((((.{((((.,,.....))))}.......(((.(((((..{((,{((((((........{(((((((,,{(((,,,,|}||},((((((({...})))))))..,,..........{{{{..(((((....))))),,))))||,...,.........,,((({((((((((,...,{{(((({.(((((((..((.(((,,{............}}).)).})))))).,}},|{(((((.,,((....)).},)))))))}})))))))))))).))))...))))))))...)))))))))}))))).))).((((((((.(((..((....((((({...}))))).{(((((..{.{((..,.(((..(((((........))))).)))}..,)}}}..)))))|((((((....)))))),(((.(((((((.{.{........}.}))))))))))))..))).)))))))),.((((((((...{((((((.((((((((((,,{{{{{.,{(((((....)))}||,.,|}|}},,..,.||{|,||,.,,},.,}.},,......{((((((((((,.........{(((((((.{.({(({...,,.(((((......))))){{((((({,{{..{{{.(((((..(((.........)))..))))).}}},,.|,.,.,||||,,,)))})))},,|{,,......}})))))).)))))))))))))))))))).......)))))))))).))))))).)))))))).,...))))).)))))))).))))))))))))).,.))))))}.,})))))..},.)))))))))).))))).)},,({(((((((((((((,,({{,....})))..)))))}.....,))))))).)}||{{{.(((((((.....))))))).(((((((....)))))))})}},..(((((((.......(((((..(((((.....)))))...))))))))))))...))))}})))))))))))))))))))).))))))))))))).}).})))))))))}...{(((({{(({.{,|.{|||,{{{.,,,,))),))}}.)}),)))}}........)}}}}..)))))))))..)))))).,,,,,........((((((,.((({...}))).,))))))...)))))).))....)))))))))))}......{(((((((.((((.(((.(((((((((.........)))).(((((((((((((...)))).))))..))))))))))))).)))))))))))}...)))))).)))))))))))).....((((((((((((.,.....,.)))))))))))))))))))))))},}}))}))))))))..))).))..)))....,(((((((....)))))))))).))))))))))).))))))...)))...))..,)))))...)))))))))))))))}}))),)))))})))},}))))))))..}||,....{{((((((((.({((((((,{.((((((....)))))).}.})},............{(((({...)))))}..,}))))}.))))))))))}}},..

Transcripts

ID Sequence Length GC content
GUGCCUUGAGGUUGCGGGUCAGCGCGAGCCGCUGCAGUGAGUCCGUCAC… 3024 nt 0.4067
Summary

Enables phosphatase binding activity and protein domain specific binding activity. Involved in calcineurin-NFAT signaling cascade and positive regulation of transcription by RNA polymerase II. Part of calcineurin complex. Implicated in Alzheimer's disease and dilated cardiomyopathy. [provided by Alliance of Genome Resources, Jul 2025]

Forensic Context

A study in mice demonstrated that long-term adolescent exposure to MDMA induced a chronic transcriptional signature of 1028 dysregulated genes in the cerebral cortex, with functional enrichment in neurotoxicity pathways including MAPK and Wnt signaling, neuroactive ligand-receptor interactions, and long-term potentiation and depression [Eun et al. DOI:10.1016/J.Taap.2009.02.027].