Basic Information

Symbol
PPP3R2
RNA class
mRNA
Alias
Protein Phosphatase 3 Regulatory Subunit B, Beta PPP3RL Protein Phosphatase 2B Regulatory Subunit 2 Calcineurin B, Type II (19kDa) Calcineurin Subunit B Type 2 Calcineurin B-Like Protein Calcineurin BII CNBII CBLP Protein Phosphatase 3 (Formerly 2B), Regulatory Subunit B (19kD), Beta Isoform (Calcineurin B, Type II) Protein Phosphatase 3 (Formerly 2B), Regulatory Subunit B, 19kDa, Beta Isoform (Calcineurin B, Type II) Protein Phosphatase 3 (Formerly 2B), Regulatory Subunit B, Beta Isoform Protein Phosphatase 3, Regulatory Subunit B (Calcineurin B)-Like Protein Phosphatase 3 Regulatory Subunit B Beta Isoform Protein Phosphatase 3, Regulatory Subunit B, Beta PPP3R1-Like
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses

MANE select

Transcript ID
NM_147180.4
Sequence length
3366.0 nt
GC content
0.4349

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-951.30 kcal/mol
Thermodynamic ensemble
Free energy: -1014.97 kcal/mol
Frequency: 0.0000
Diversity: 887.42
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((................)))).((((.((((....)))).)))).((((((..(((((((((((..(((((((((.....))))..(((((....(((.((((.....(((.(((...((((((...(((.(((((.....(((((.((..((((.(((..(...(((((((((((((..(((..(((((((((((.....((((((((((((.((((.....)).)).))).))))))))).((((..(((((((((((((((((.....)))((((.....))))((((..((((......))))..)))).....))))))))))).)))..)))).......((((....((((....)))))))).(((((((((((((((.((((..((((((((((((((......))).)).(((((((.((....)).))))))).......(((((.(((((((.....))))))).)))))((((((......((((((..(((((.((((((((((....))))....)))).))..)))))))))))..(((.(((((.(((((((...((((...............))))(((((((((((....((((.(((((((((......((((...(((.....))).....))))((((((.......(((((((......((((...))))))))))).........)))))).....((((((((((((((.....))))))........)))))))))))))))))...))))....)))))).)))))))))))).))))).)))....))))))..(((((........))))).........((((((...)))))).......(((((..(((((....)).)))..)))))))))))))))))).))))))......((..(((((...(((((...(((((..(((....(((((((.(((..(((((.(((..(((((........((((.((((((((..((((((((((....)))))))))).((((...((.((((((......((.((((((.(((......))).)))))).))..)))))))).))))..((((.(((.((((((((......))).).))))))).)))).(((((.((....)).))))).(((((((.((((((((((.(((((((........).)))))))))......)))...(((.(((.(((.(.....).)))))).))).....((((..(((((.(((((((.(((....))).))))))).((..((((......))))..))((....)).)))))..))))..((((.....((((...))))..))))(((.(((((....((((.........))))((((.((((((..(((.....))).))))))))))))))).)))))))..)))))))))))))))))))((((((..((((((((...))))))...((((.((((........)))))))).((((....))))(((((.......))))).(((((((.....))))).))((((((...))))))((((((((((...(((((((.(((((((....)))))(((((((((.....))))....)))))(((((.(((.((.....))))).........(((((((.((...((.....))((((((...)))))).)))))))))..)))))...)).)))))))(((.((((.......)))))))..))))))))))..))..)).))))..(((((((((((........)))))))))))..)))))))))))))..))).))))))))))))))).....))))))))))..))..))))))))).)))))..((((......))))))))))))).))))))))..)))))....)..)))))))..)).)))))))))).)))..))))))...)))..))).)))))))))))).....(((((...(((((((((.(((..((((................(((((((...(((.((....((((.......(((((.((((.....)))).)))))..))))....)).)))..))))))).))))..)))..)).)))))))..)))))..))))).))))))))))).............................................((((((.(((..........))).))))))........((((((.....(((.((((((((((((((((..(((((((((.............))))))))).............((((((((.((..((((((((((.......))))))..(((((((((((..(((((((......))))))))))))...))))))..)))).))))))))))....(((((((((....(((((((((((..(((((((....((((((((((((((((........((((((..(((((......))))).))))))........))))))))((..((....))..)).......(((((((.((((...((((((..(((..............(((((((.(((.......(((..((((((...((((((((...(((.(((...((((.........))))..)))...)))...............(((((((..((.....))..)))))))..((((..(......)..))))..........))).)))))...)))))))))))).)))))))....((((...))))..(((.(((..(((((.((((......)))))))))..)))))).............((.....))))))))))).....)))))))))))((((.......)))).........((((....)))).....))))))))............((((............(((((((......)))))))...........))))............)))))))))))))))))).....)))))))))...)))).....)))))).))))))))).....)))))).(((((((((((((((((..((((((((((..((...(((.(((((((((((.......((((((.(((((((((((((..((((..((....))..))))))))))))..)))......(((..(((..((((((......))))))...)))..))))).))))))........)))))).)))))))).)).))).......)))))))..)))............))))))))))))))))))))..
Thermodynamic Ensemble Prediction
((((................)))).((((.((((....)))).)))).((((((..(((((((((((..(((((((((.....))))..{{{{,....{,..,..,...,,|{{.(((...((((((...(((.((((({{..(((((..((((((.,.{{{.{({((((((((({(((((.,{,,,,{|{((((((((({.....,.})))))))){(((({({.((.((((((.({((,,,|}||,|||}||.||{{,((((,{(((.....))))||||.},})))}{,||,.||||..,||.}}})||||((((((((((.(({.(((.....))}....{{...((((....((((....)))))))).}}{(((....}))).(((((({((((.{(.((((({......))}....(((((((.((....)).))))))).......(((((.(((((((.....))))))).))))),{{{.....},,{(((((..(((((.{(((((((((....))))....))))}.}..))))))))))}..|,,.,,})).}}.)))).},}))))))))...))))))))))||{{((((((((,{..{{{,.(((((((((.,|||,|{{{..,(((,..,,}}}....,||||((((({......,(((((((......({{{...)))}))))))}}}.......}))))}.....,(((((((((((((.....))))))...,,...})))))},)))))))))...,))}....))))))||}}}}|,(({{{,({{{{{,.....,,,,,,,,.{{{{(,|{,....}}))).,.,.....((((({...)))))).......{{{,({{(,,{{....}}|}}}..}}}||,,,.,..,{{{,{{||{|(((,,.,,.((((((((((.(((((((...(((((...........,,....)))))))))))))),}))))))).,}})))))}||||||||,((((((((({....}))))))))),|{{{,..{{,{{{{||,||,..{{.{(((((.(((......})).)))))},)),})|||||||||},..,{{{{||,{{(((,,(((......)))})))),},)).)))|.(((((.((....)).))))),|{|||||,||{{|,|(((.(((((({........).))))))))).....{(({.,{(((.(({{(((.{.....}.)))))).))}.}}..)))}..,,|||.(((((((.(({....))).))))))).{{..((({......))))..))||,..,}}.}}}},.,,(((,,(((,,,,||||,,|}}....{,(({{({{.{{{{{|,|,||{({{.{,,{{.,,,)||||.|||{,{,,|||,,,,.))}.}))))))))}))))),))))))}}.)))))}))|||||}|(({.,,((({{{|(((((({...))))))}..((((,({((.....,..)))|}}}).{{{,....})))||{{{,,||},|)))|},||(((((.....))))}.)}{(((({...})))))||,|,{{{{{{|.||{{|({...{({{{....))))}})).,}},,)))}},}}),,,},})).,.}}},.|}}}),}.}}))),},,.},..|}||||{{({((.,,||}}},.|,((((((...)))))).|||||||}}|{....}},)},}.})))))})}}}},,.........(((((((((,{,.,.,{{{,|||{{{({{{,.(((((((((((........))))))))))).}}||{{,|{,..,,})}.}}},......})))),)).))),,,...,}}.))))))))).))))))..)))))((((......)))){{{{{,,,,.,,,,))))}{{|||}....,.,|}}}))),}))},,)))))))).)))..))))))...))}..}}}.,|{{{{..,)))},...((((({(.(((((((((.{{({.{((({.....{({{{{....{{,,,,,...(((.{{....{{({...,,..{||((.((((.....)))).))}||{{||}}...,))})))}})))),,..,))),,))}..)).))))))).))))))..))))).))))))))))).......................,{,{..............,,,,((((((.(((..........))).))))))........,(((((.....(((.((((((((((((((({..(((((((((.............))))))))).............((((((({{((..((((((((((.......)))))),.((((((({(({.,(((((((......))))))))}))}...))))))..,))).))))))))))....(((((((((....(((((((((((..(((((({....((((((((((((((({...,,,..,,,,{|.,(((((......))))}.||||||....,},,)),|||,|((..{{....||,.|}.....,,(((((((.((((...((((((.,{({............{{(((((((.(((,......,{(..((((((...((((((((...(((.(((...((((.........))))..)))...,}}...............(((((((..((.....))..)))))))..((((..{......}..))))..........))).)))))...))))))}))))).)))))))}...((({...))))..(((.(((..(((({,((((......)))))))))..))))))....................),))))))))}.....))))))))))){{{{...,,..)))}.,}}..,,.((((....)))).....))))))))............(((({{,..,||}...(((((((......))))))}...,,,.....))))..,,........)))))))))))))))))).....)))))))))...}))).....))))))}})))))))).....)))))}.(((((((((((((((({..(((((((,,(,.,,{{,{((.(((((((((((.......((((((.(((({((((((((,,(({{,.,,.,..)),,))},}}))))))..))),.....(((..(((..((((((......))))))...)))..)))}).))))))....,...)))))),,))))}))}},.,,,.,,....)))))))..)}}..........,)))))))))))))))))))))..

Transcripts

ID Sequence Length GC content
GCUCCCCUCUCCGACCCUUUGAGCCGUGGCCGUUGCCAGAUGUCCACAA… 3366 nt 0.4349
Summary

Enables calcium-dependent protein serine/threonine phosphatase regulator activity. Predicted to be involved in calcineurin-mediated signaling. Predicted to act upstream of or within penetration of zona pellucida. Predicted to be located in cytosol. Predicted to be part of calcineurin complex. [provided by Alliance of Genome Resources, Jul 2025]

Forensic Context

A study in rhesus macaques demonstrated that chronic ethanol self-administration is associated with broad transcriptomic changes in the brain, where the PPP3R2 was identified as a hub gene in the cortical Area 32 coexpression network correlated with ethanol intake [Iancu et al. DOI:10.1111/Adb.12501].