| ID | Sequence | Length | GC content |
|---|---|---|---|
| GUCACGCUAGAAGAGCCGUCUGCUGACUGCACGUGUGUGUGCACACUCG… | 500 nt | 0.5920 | |
| AUCCGGCCUGAGGCAGGUGCUCGCUUGGUCUAGUGCCCAUUUACUCUGG… | 468 nt | 0.6026 |
This gene encodes a member of the neuropeptide Y (NPY) family of peptides. The encoded 95 aa preproprotein is synthesized in the pancreatic islets of Langerhans and proteolytically processed to generate two peptide products. These products include the active pancreatic hormone of 36 aa and an icosapeptide of unknown function. This hormone acts as a regulator of pancreatic and gastrointestinal functions and may be important in the regulation of food intake. Plasma level of this hormone has been shown to be reduced in conditions associated with increased food intake and elevated in anorexia nervosa. In addition, infusion of this hormone in obese rodents has shown to decrease weight gain. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Jan 2016]
A study in a rat model of acute carbon dioxide poisoning demonstrated that the PPY mRNA expression in the hypothalamus was significantly decreased in the 60% CO2 exposure group compared to groups exposed to 10% and 20% CO2 [Sato et al. DOI:10.1016/J.Legalmed.2015.07.014].