Basic Information

Symbol
PRAC1
RNA class
mRNA
Alias
PRAC1 Small Nuclear Protein C17orf92 PRAC Prostate Cancer Susceptibility Candidate Protein 1 Prostate, Rectum And Colon Expressed Gene Protein Prostate Cancer Susceptibility Candidate 1 Small Nuclear Protein PRAC1 Prostate Cancer Susceptibility Candidate Chromosome 17 Open Reading Frame 92 Prostate, Rectum And Colon Small Nuclear Protein PRAC
Location (GRCh38)
Forensic tag(s)
Mixture deconvolution Tissue/body fluid identification

MANE select

Transcript ID
NM_032391.3
Sequence length
382.0 nt
GC content
0.4869

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-114.00 kcal/mol
Thermodynamic ensemble
Free energy: -121.21 kcal/mol
Frequency: 0.0000
Diversity: 78.56
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..(((((.((((((.....(((((.(.....).))))).))))))((((..........))))...(((((((((......)))))))))(((...(((((((.....((((.(((((.....(((......))).....)))))))))....))))))).)))..........((.(((((((.((((((........)))))))).)).))).))..((((..((((......))))....))))((((((.(((....(((((((((((.....(((((((.(......).))))).))...))))))))))).))).))))))...((((..((((...)))))))).........................))))).
Thermodynamic Ensemble Prediction
..(((((,((((((.....(((((.{.....}.))))).))))))|(((,{,....}},)}}}...(((((((((......))))))))){((...(((((((.....{(((.{((((,....(((......,,)}}...))))))})}....))))))).}}},,,.......{{.{((((((.((((((........)))))))).}}.))).)}..((((..((((......))))....))))((((((.(((....(((((((((((.....(((((((.(,.....),))))).)).,.))))))))))).))).))))))...||||,,||||,,,)})},,.,,,......,,,,.............))))).

Transcripts

ID Sequence Length GC content
CCUUCCUCUCCUAGCCUAAGGCGUGCAAACAGAGCGCCACUGGGAGGCU… 382 nt 0.4869
Summary

This gene is reported to be specifically expressed in prostate, rectum and distal colon. Sequence analysis suggests that it may play a regulatory role in the nucleus. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans established a multiplex system using coding single nucleotide polymorphisms (cSNPs) within semen-specific mRNA markers to deconvolute the semen donor in mixed body fluid stains [Liu et al. DOI:10.1016/j.fsigen.2021.102483]. The system incorporated the semen-specific mRNA marker PRAC1, which contains the cSNP rs1054072, and demonstrated high sensitivity and specificity, successfully typing the semen contributor in laboratory-generated mixtures with other body fluids at ratios as low as 1:10 for semen-blood and up to 1:200 for semen-menstrual blood, with genotyping results from cDNA being concordant with genomic DNA.