| ID | Sequence | Length | GC content |
|---|---|---|---|
| CCUUCCUCUCCUAGCCUAAGGCGUGCAAACAGAGCGCCACUGGGAGGCU… | 382 nt | 0.4869 |
This gene is reported to be specifically expressed in prostate, rectum and distal colon. Sequence analysis suggests that it may play a regulatory role in the nucleus. [provided by RefSeq, Jul 2008]
A study in humans established a multiplex system using coding single nucleotide polymorphisms (cSNPs) within semen-specific mRNA markers to deconvolute the semen donor in mixed body fluid stains [Liu et al. DOI:10.1016/j.fsigen.2021.102483]. The system incorporated the semen-specific mRNA marker PRAC1, which contains the cSNP rs1054072, and demonstrated high sensitivity and specificity, successfully typing the semen contributor in laboratory-generated mixtures with other body fluids at ratios as low as 1:10 for semen-blood and up to 1:200 for semen-menstrual blood, with genotyping results from cDNA being concordant with genomic DNA.