| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGCACAGAGUUGGGAGUGACUCCAGAGCCUCCUGCAAGAUGCUGUUGAU… | 1431 nt | 0.5772 |
This gene encodes a member of the heterogeneous family of basic, proline-rich, human salivary glycoproteins. The encoded preproprotein undergoes proteolytic processing to generate one or more mature isoforms before secretion from the parotid glands. Multiple alleles of this gene exhibiting variations in the length of the tandem repeats, polymorphic cleavage sites and polymorphic stop codons have been identified. This gene is located in a cluster of closely related salivary proline-rich proteins on chromosome 12. [provided by RefSeq, May 2023]
A study in human samples demonstrated that the PRB2 was identified as a reliable protein for saliva identification, being detected in 48 out of 50 saliva samples with an average sequence coverage of 46.64% [Brown et al. DOI:10.1021/acs.jproteome.5c00711].