| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGCACAGAGUUGGGAGUGACUCCAGAGCCUCCAGCAAGAUGCUACUGAU… | 1227 nt | 0.5860 | |
| AGCACAGAGUUGGGAGUGACUCCAGAGCCUCCAGCAAGAUGCUACUGAU… | 1101 nt | 0.5822 |
This gene encodes a member of the heterogeneous family of basic, proline-rich, human salivary glycoproteins. Multiple alleles of this gene exhibiting variations in the length of the tandem repeats have been identified. The reference genome encodes the "Long" allele. The protein isoforms encoded by this gene are recognized as the "first line of oral defense" against the detrimental effects of polyphenols in the diet and pathogen infections. This gene is located in a cluster of closely related salivary proline-rich proteins on chromosome 12. [provided by RefSeq, Nov 2015]
A study in humans demonstrated that the PRB3 is a saliva-specific mRNA containing a coding region SNP (cSNP) used for directly associating body fluids with donors in forensic mixtures [Ingold et al. DOI:10.1007/s00414-020-02252-w]. Subsequent research developed a target RNA sequencing panel including the PRB3, where it showed expression almost restricted to saliva and contributed to a cumulative discriminatory power of 0.987325116 for saliva identification, though the SNP rs1896551 on this transcript was noted to be affected by heterozygous imbalance [Yu et al. DOI:10.1016/j.fsigen.2025.103416].