| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGCACAGAGUUGGGAGUGACUCCAGAGCCUCCAGCGAGAUGCUGCUGAU… | 716 nt | 0.5489 | |
| AGCACAGAGUUGGGAGUGACUCCAGAGCCUCCAGCGAGAUGCUGCUGAU… | 923 nt | 0.5623 |
This gene encodes a member of the heterogeneous family of basic, proline-rich, human salivary glycoproteins. The encoded preproprotein undergoes proteolytic processing to generate one or more mature peptides before secretion from the parotid glands. Multiple alleles of this gene exhibiting variations in the length of the tandem repeats have been identified. The reference genome encodes the "Small" allele. This gene is located in a cluster of closely related salivary proline-rich proteins on chromosome 12. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Nov 2015]
A study in humans demonstrated that the PRB4 is a protein identified as a biomarker for saliva in a streamlined, protease-free mass spectrometry assay, where it was detected in 48 out of 50 saliva samples with 44.74% average coverage but was not detected below a 50-fold dilution in sensitivity tests [Brown et al. DOI:10.1021/acs.jproteome.5c00711]. In a separate human study, the PRB4 was also utilized as an mRNA marker (PRB4_G) included in a final targeted sequencing panel for saliva identification [Neis et al. DOI:10.1016/j.fsigen.2024.103125].