| ID | Sequence | Length | GC content |
|---|---|---|---|
| GGCGCUGAGAACGCGGGUCCACGCGUGUGAUCGUCCGUGCGUCUAGCCU… | 925 nt | 0.5816 |
This gene encodes a member of the peroxiredoxin family of antioxidant enzymes, which reduce hydrogen peroxide and alkyl hydroperoxides. The encoded protein plays an antioxidant protective role in cells, and it may contribute to the antiviral activity of CD8(+) T-cells. The crystal structure of this protein has been resolved to 2.7 angstroms. This protein prevents hemolytic anemia from oxidative stress by stabilizing hemoglobin, thus making this gene a therapeutic target for patients with hemolytic anemia. This protein may have a proliferative effect and play a role in cancer development or progression. Related pseudogenes have been identified on chromosomes 5, 6, 10 and 13. [provided by RefSeq, Mar 2013]
A review of forensic proteomics literature notes that the PRDX2 is identified as a protein marker whose abundance increases post-mortem in cerebrospinal fluid for early post-mortem interval estimation in humans [Alex et al. DOI:10.1016/j.scijus.2025.101320]. A study in mice demonstrated that the PRDX2 transcript increased in relative abundance within 0.3 hours postmortem in zebrafish [Pozhitkov et al. DOI:10.1098/rsob.160267]. In a separate mouse model of radiation-induced skin injury, serum protein spots corresponding to the PRDX2 showed an early decrease in expression following ionizing radiation exposure [Guipaud et al. DOI:10.1002/pmic.200601032].