Basic Information

Symbol
PRDX2
RNA class
mRNA
Alias
Peroxiredoxin 2 NKEFB PRP TSA Thioredoxin-Dependent Peroxide Reductase 1 Thioredoxin Peroxidase 1 PRXII TDPX1 PRX2 Natural Killer Cell-Enhancing Factor B Thioredoxin-Dependent Peroxiredoxin 2 Thiol-Specific Antioxidant 1 Peroxiredoxin-2 MGC4104 NKEF-B Torin Epididymis Secretory Sperm Binding Protein Li 2a Thiol-Specific Antioxidant Protein Natural Killer-Enhancing Factor B EC 1.11.1.24 EC 1.11.1.15 EC 1.11.1 HEL-S-2a PTX1 TPX1
Location (GRCh38)
Forensic tag(s)
Postmortem interval inference Cause of death analysis

MANE select

Transcript ID
NM_005809.6
Sequence length
925.0 nt
GC content
0.5816

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-344.00 kcal/mol
Thermodynamic ensemble
Free energy: -359.62 kcal/mol
Frequency: 0.0000
Diversity: 251.84
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((((((..(((((.(....).)))))..))).....)))))..((((((.(((((((.(((((((((((((((.((((((.........))))))..))))((((...((((((.((((.((((.((((..(((((((((((....)))))...))))))(((((((............)))))))...........((((((.((..(((....)))(((...(((((.....))).))...)))...)).))))))....))))..)))))))).))))))...)))).....((((((((...))))))))...((((...((........)).))))....((((.(((....)))))))((((.(((((.(((((((((.(((((((((((....))))..)).)))))..((((((.........((((((...(((....((((((((......(((.((((....((((((((.((.(((((((.......)))))))..)).)))))))))))).)))))))))))......)))....)))))))))))).))).)))))).))))).)))).......)))))))))))...)).))).((((...........))))...........(((.......)))...((((....((((.((((.....)))).))))))))....(((((.((.((((((((((((((.....(((.(((....(((((((((.....))..)))))))...))))))......(((((((...(((........)))...)))))))(((((...((((........))))...)))))..(((.....................))).)))))))).....))))))))..)))))...............)).)))))).
Thermodynamic Ensemble Prediction
((((((((..(((((.{....),)))))..))}.....)))))..((((((.(((..,,,((((((((...((((.((((((.........))))))..))))....)))|({((.{((((,,,((,{{{||||,|||((((((....)))))},,)))))}(((((((....,.......))))))).........,.((((((,{(..{{{....)))(((...{((((.....))).}}.,.|||...}},)}|}||.,||||||,,{{(((({{{{{..{.{,,(((((((.,(((((((.((((((.((..((((((((..((.......{(,{{{,,....,|||.||{,{{{||,,,,,{{((.(((((.(((((((((.(((((((((((....))))).)}.)))))..((((((.........({((((...(((..{.(((((({,....,((((.((((....((((((((.((.(((((((.......)))))))..,).)))))))))))).))))))))))),.|||.}}}.,,,)))))})))))).))).)))))).))))).)))){{{,.(({{{(|,,.}))),))),),)}}|,......)))}},.|{|,..,,,,,,..(({.......)))...{{{{...,((((.((((.....)))).)))))))).))..))).)))))..)).)))))).))))))).,.,......((((((({{.....}}..))))))).{(((((.{.((((.(((((((...(((.,....,})))...))))))).))))....)))))}.(((.((.((......)).)))))...}.)))))))..,....}))})},)))))})).,.,,))))).))))).......,}}}}....))))))))).

Transcripts

ID Sequence Length GC content
GGCGCUGAGAACGCGGGUCCACGCGUGUGAUCGUCCGUGCGUCUAGCCU… 925 nt 0.5816
Summary

This gene encodes a member of the peroxiredoxin family of antioxidant enzymes, which reduce hydrogen peroxide and alkyl hydroperoxides. The encoded protein plays an antioxidant protective role in cells, and it may contribute to the antiviral activity of CD8(+) T-cells. The crystal structure of this protein has been resolved to 2.7 angstroms. This protein prevents hemolytic anemia from oxidative stress by stabilizing hemoglobin, thus making this gene a therapeutic target for patients with hemolytic anemia. This protein may have a proliferative effect and play a role in cancer development or progression. Related pseudogenes have been identified on chromosomes 5, 6, 10 and 13. [provided by RefSeq, Mar 2013]

Forensic Context

A review of forensic proteomics literature notes that the PRDX2 is identified as a protein marker whose abundance increases post-mortem in cerebrospinal fluid for early post-mortem interval estimation in humans [Alex et al. DOI:10.1016/j.scijus.2025.101320]. A study in mice demonstrated that the PRDX2 transcript increased in relative abundance within 0.3 hours postmortem in zebrafish [Pozhitkov et al. DOI:10.1098/rsob.160267]. In a separate mouse model of radiation-induced skin injury, serum protein spots corresponding to the PRDX2 showed an early decrease in expression following ionizing radiation exposure [Guipaud et al. DOI:10.1002/pmic.200601032].