| ID | Sequence | Length | GC content |
|---|---|---|---|
| GUGGCGCCCGAGUGCACUGAAGAUGGCGGCUGCUGUAGGACGGUUGCUC… | 1387 nt | 0.3872 | |
| GUGGCGCCCGAGUGCACUGAAGAUGGCGGCUGCUGUAGGACGGUUGCUC… | 1553 nt | 0.4018 |
This gene encodes a mitochondrial protein with antioxidant function. The protein is similar to the C22 subunit of Salmonella typhimurium alkylhydroperoxide reductase, and it can rescue bacterial resistance to alkylhydroperoxide in E. coli that lack the C22 subunit. The human and mouse genes are highly conserved, and they map to the regions syntenic between mouse and human chromosomes. Sequence comparisons with recently cloned mammalian homologs suggest that these genes consist of a family that is responsible for the regulation of cellular proliferation, differentiation and antioxidant functions. This family member can protect cells from oxidative stress, and it can promote cell survival in prostate cancer. Alternative splicing of this gene results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 1, 3, 13 and 22. [provided by RefSeq, Oct 2014]
A study in mice demonstrated that the PRDX3 was upregulated in common in splenocytes at day 7 post-injury following both burn and trauma-hemorrhage, where it was categorized as a gene expression marker for chromosome segregation [Lederer et al. DOI:10.1152/physiolgenomics.00086.2007]. In human sepsis patients, proteomic and transcriptomic analyses identified the PRDX3 as a potential biomarker, with its mRNA expression pattern found to be consistent with its corresponding protein level, indicating it was lowly expressed in the sepsis group based on RNA sequencing data [Wang et al. DOI:10.2147/IDR.S380137].