| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACAGUGGGCUGCCUGGGGGGCUGAUGCCACCAUUCCAGGAGCCUCGGUG… | 2500 nt | 0.5980 | |
| ACAGUGGGCUGCCUGGGGGGCUGAUGCCACCAUUCCAGGAGCCUCGGUG… | 2474 nt | 0.5974 |
This gene encodes a protein with structural similarities to complement component C9 that is important in immunity. This protein forms membrane pores that allow the release of granzymes and subsequent cytolysis of target cells. Whether pore formation occurs in the plasma membrane of target cells or in an endosomal membrane inside target cells is subject to debate. Mutations in this gene are associated with a variety of human disease including diabetes, multiple sclerosis, lymphomas, autoimmune lymphoproliferative syndrome (ALPS), aplastic anemia, and familial hemophagocytic lymphohistiocytosis type 2 (FHL2), a rare and lethal autosomal recessive disorder of early childhood. [provided by RefSeq, Aug 2017]
A study in humans demonstrated that the PRF1 is a lysosome-related gene whose expression was significantly higher in peripheral blood from normal controls compared to sepsis patients, and high expression correlated with a higher 28-day survival rate in sepsis patients, with single-cell RNA sequencing localizing its high expression specifically to T cells and NK cells [Chen et al. DOI:10.1186/s12865-023-00588-7]. A review summarizing single-cell sequencing analyses in mice post-myocardial infarction identified the PRF1 as an effector molecule from CD8+ T-cells that promotes apoptosis and endothelial cell shedding, contributing to plaque erosion [Xinxin Bian et al. DOI:10.3892/mmr.2025.13680].