Basic Information

Symbol
PRH2
RNA class
mRNA
Alias
Proline Rich Protein HaeIII Subfamily 2 Pr Acidic Salivary Proline-Rich Protein, HaeIII Type, 2 Salivary Acidic Proline-Rich Phosphoprotein 1/2 Parotid Proline-Rich Protein 1/2 Parotid Double-Band Protein Parotid Acidic Protein PRP-1/PRP-2 Protein C Pr1/Pr2 Parotid Isoelectric Focusing Variant Protein Parotid Proline-Rich Protein PIF-S Db-S Pa
Location (GRCh38)
Forensic tag(s)
Tissue/body fluid identification

MANE select

Transcript ID
NM_001110213.1
Sequence length
3177.0 nt
GC content
0.3680

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-737.10 kcal/mol
Thermodynamic ensemble
Free energy: -803.61 kcal/mol
Frequency: 0.0000
Diversity: 920.11
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((....((((((((((.((((((.((.((((((.....(((.(((((......))))).)))(((((((((.....)).))))..)))...(((((((((((((((((..((((...(((...(((((((((..(((((((((((....(((((((........(((((((.((...(((((......(((..((........))..))).((((((((((.(((..(((......))))))))....(((.....))).........))))))))......)))))...)))))))))((((((((((...((......))....(((((.(((((((..((((.....)))).((((....)).))..(((....))).((((.(((.((.......)).))).))))....((((..((((....((((((((........)).)))))).....((((..(((...(((((.(((........)))...)))))...)))..))))........))))..))))(((.((....)))))...........((((((((...(((.(((.((((((((((((.....)))))))))..))).))).......................(((((((((((((((((..(((((.((((((....((....(((.(((..((((.(((........))).))))....))).((((..(((((((.((((.......)))).)))))))...)))).....((((((((((.(((((.((........((((((((.((((((((..((((((((.((.((((((..((...((((((.((((((..((((.....(((((((((((......)))))..(((((((..((((..(((((((.(((....(((((((...........((.(((...))).)).((((((....)))))).......(((((((((.((....)).))))))))).))))))).))).))))))).....)))).)))))))((.(((((((.((((((.((.((..((((((.(((..((((((.((((.....((((((............)))))).....))))))))))..))).)).)))).((((.(((((.((((.(((((((......))))))).))))..(((((....................)))))...((((((........))))))............)))))..))))...............)).)).)))))).....))))))).))))))))....))))..))))))...)).))))..))..)))))).)).))((((.......))))..))))))...))))))))......(((((...))))).......((((.....(((((((......((((((((((((....((((((((....(((.(((((((((((....)))........)))))))).)))..)))))))).........((((((((((....)))))))).)).........((((..(((............................(((((((.((((((((.((.(((.....))).))...))))))))..)))))))........((((((.(((..((((.((((...)))).((((((.......((((..(.....)..))))((((((((.....(((((...(((..((..(((...((((.................)))).)))..))..)))..))))).....))))))))(((((((((...............)))))))))....((.(((....))))).((.(((((.(((((((((....(((.((....)).)))....)))))))..)).))))).)).)))))).............(((((....))))).....((((.((((((.....(((((........)))))..((((...))))...(((((.(((((((((............))))))))).)))))...)))))))))))))).....(((((((((((..............(((((((((.......((((...((......)))))).......))))))))).....(((......((((((((....))))))))....))).......)))))))))))......))).))))))........)))..))))...)))))))))))).)))))))....)))).........)))))))))).))))))))).))))))...((((((.(((((......))))))))))).............................((.(((((....))))).)).)))..))....)))))).)))))........((((((.((....(((((..(........)..)))))....)).))))))..))))))...))))))))))).)))...))))))))..((((.......))))..............))))))).)))))...(((..((((..(((((......)))))..))))))).)))))))))).))))))).(((((........)))))))))).......))))))......))))))))).....)))...))))((((((.(((((.(.((((((((((....)))))...))))).))))))...)))...))).........(((...(.((((.........((((((.....))))))......((((((...)))))))))).)...)))..(((((((((((((..((.........)).)).))).))))))))...)))))))...))))))))))....(((((.......)))))....((((((((......)))))))).....(((................)))............)))))).)).))..)))))))).......(((((.((((((((((....)))))).))))..)))))((.((((.((((((.((....)).)))))))))).))..))))))....(((....((((((((.....)))).))))......)))(((((.((.(((((........))))).)).)))))..))).
Thermodynamic Ensemble Prediction
.(((....((((({(((,{(({(((,((.{(((((.....(((.(((((......))))).}))(({((((((.....)).))))..}))...(((((((((((((((((...(({....||}..(((((((((..{((((((((((....(((((((........{((((((.((...(((((......(((,.({......,,))..})).((((((((,.{(((..|||......|||{{||,...}}||.}},,)}}.....,,.,))))))))......)))))...))))))))}((((((((({...((.....,)}....(((((.(((((((,,{{{({{{{.||||.(((,....||.||.,((,....))).||||.|||.,|}}.}}}}.)}))).))||....||.,....|,....((((((((........)).)))))).....{{{{,,{||,..(({{{.(((,.....,})),..{|||{{{..,,....)).}}}))...))))}.|,}{{{(.((....)))))}..,...{{,.((((((({...{{{.(((.((((((((((((.....)))))))))..})).))).,.....................{((((((((((((((((..{{(({.{((((({{{.(({.....|}|||}.((((.(((........))).)))).,..}}}.|(((..(((((((.((((.......)))).))))))),..))}},,,..((((((((((.(((((.{{..,.....((((((((,(((((({{..{{{{{{|||||||(({({,,(({(((((((({........,{{,.....,,{{{,(((((......))))).,||{{,{{..(((({{,,,,|||}||,....,((((,...........}}|},,|.,})))})}}{(((({....}))))).,||,,.{((((((((,((,,,,}|,}}}}}|}}}.|||||||.}|}{||}}}}}..,}}}})).}})))))|}}}||||{{,{,,,,,.,,.,,..{{{({{.(((..((((((.((((.....((((((............)))))).....))))))))))..))).}},}}}},|||{.{(((({(((({,,((((,{{{,,.,}}}}))})))},,{((((..,,.,.,,.......}}..)))))||,|{||||,..,,,,,)}}))}.,,....,,,..})))),,)))|..............|}},}},,,,,,,..,|,|}}}}}}}}},,,,,,|||{|,,,,...||||{,,,,,||,,|{||{{,|,,,,...,.)||||}.,.}}})}}}..,}})}}...,}}}}}||......(((({...}))))....,,.{{{{.....(((((((......{(((((((((((....{{((((({....(((.,((({((({(,,,,,|||{,,.,,,,}}}|||||,|}}..}}}}}))}..,,.....{{((((((((....)))))))).}}..,.......,.(((((((.{{........................(((((((.((((((((.((.(((.....))).))...))))))))..))))))),,,...))))))),.{,,..,,...{||,.,|}},,.{(((({,,,,,.{((,|..}}}}}}}|.||||(((({{{{.....{((((...{{{.,((..,{,....,{{||,|{..,,|,..,,})}}}}.}}}..}}.,}}}..})))).{{{{|}||,||,(((((((((...............))))))))).,,.|,}}}}}.....||,{({,,,||||{{,,||||,.}}}|,,}}|,,.,|{{{{{{{{...,,)))}))))))}))})),}))))}.......,,{{..(((((....))))).....{((({{|||||,|||.{....,)))))}})),,,..|||,.,,))}),,,|||||,{|||||||{,,,,,,,}{{{{|}},,,,,)})))}|.,.,,..,}},,||||,.....(((((((((((........,{,...{((((((((,{{,...{(((...{{......))))))....}}}))))))))).....(((......((((((((....))))))))....)))......,)))))))))))......{||.,||,|{,....},)}.},.,.,)}}})))))))))))).)))))))....}}}}|,,..,},.)))))))},,.}))))))))}}))))}.,.((((({,(((((......))))))))))).,..,||,,...,,,,...,,|....},,{(.(((((....))))).)}..,},,||,,,.}})))}.})}},.....,,.((((((.((....{((((,,...,,,,..,..}}))}....)).)))))),,)))))}..,))))))))))).},,.,,)))}},})},||||,.....{((({....})))}.....))))))).)))))...,{,|.((((..(((({......)))))..)))),},})))))))))).))))))).(((((........))))))))))},,....,}}}}}......)))))))))...{(({.....)))||,(({.((({{{(.((((((((((....)))))...))))).))))))...)))...,,,,.......,{{{..,|,|{{{.........((((((.....)))))).,,,..{{{{{,..,)))))})))}.,...,,...(((((((((((((,,{(........,)).}}.})).))))))))...)))))))...))))))))))....{({{,,,|{,..,},,,....{(((((((......)))))))}.....,,{.,............,.))).,|,.,.}}}..)))))}.)}.}}..))))),},.......(((((.((((((((((....}))))).))))..))))){{,({{(,{{{{{|,,,,,,,,,.))))}|||}|{{{{{...}))}},.|||,...{{{{{{{{.,...}))},))}},,....,}}(({{{.({.(((((........)}}}}.)).)))))..))).

Transcripts

ID Sequence Length GC content
AGCAUAAAGUUGGGAGUGACACCAGAGCCUUCUGCAAGAUGCUUCUGAU… 3177 nt 0.3680
Summary

This gene encodes a member of the heterogeneous family of proline-rich salivary glycoproteins. The encoded preproprotein undergoes proteolytic processing to generate one or more mature isoforms before secretion from the parotid and submandibular/sublingual glands. In western population this locus is commonly biallelic and encodes proline-rich protein (PRP) isoforms, PRP-1 and PRP-2. The reference genome encodes the PRP-1 allele. Certain alleles of this gene are associated with susceptibility to dental caries. This gene is located in a cluster of closely related salivary proline-rich proteins on chromosome 12. [provided by RefSeq, Oct 2015]

Forensic Context

A study in humans developed an RT-qPCR procedure for discriminating nasal secretion and saliva, where the PRH2 was evaluated as a candidate saliva marker [Akutsu et al. DOI:10.3390/diagnostics10080519].