| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCACUGUGGGUAGGCGGCGGCGGCGGCGGCUACGCGGAGCGGCAGGCGG… | 9355 nt | 0.3522 |
The protein encoded by this gene is a catalytic subunit of the AMP-activated protein kinase (AMPK). AMPK is a heterotrimer consisting of an alpha catalytic subunit, and non-catalytic beta and gamma subunits. AMPK is an important energy-sensing enzyme that monitors cellular energy status. In response to cellular metabolic stresses, AMPK is activated, and thus phosphorylates and inactivates acetyl-CoA carboxylase (ACC) and beta-hydroxy beta-methylglutaryl-CoA reductase (HMGCR), key enzymes involved in regulating de novo biosynthesis of fatty acid and cholesterol. Studies of the mouse counterpart suggest that this catalytic subunit may control whole-body insulin sensitivity and is necessary for maintaining myocardial energy homeostasis during ischemia. [provided by RefSeq, Jul 2008] CIViC Summary for PRKAA2 Gene
A study in human patients demonstrated that the PRKAA2 is associated with cell motility and re-epithelialization during wound healing, where a hypoxic environment can downregulate its activity to induce downstream mTORC1 target expression [Wu et al. DOI:10.21037/atm-22-2033].