Basic Information

Symbol
PRKCA
RNA class
mRNA
Alias
Protein Kinase C Alpha PKCA Protein Kinase C Alpha Type EC 2.7.11.13 PKC-Alpha PRKACA PKC-A Protein Kinase C, Alpha Aging-Associated Gene 6 EC 2.7.11 PKCalpha PKCI+/- PKCα AAG6
Location (GRCh38)
Forensic tag(s)
Forensic psychiatry evaluation

MANE select

Transcript ID
NM_002737.3
Sequence length
8964.0 nt
GC content
0.4869

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-2989.40 kcal/mol
Thermodynamic ensemble
Free energy: -3166.28 kcal/mol
Frequency: 0.0000
Diversity: 2174.70
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((((((((((((((((((((((.(((((...)))))((((((((((((((.((((...((((((..........((((.((((....)))).((((((((((((((((.(((((((((((...((((...))))))))((((.((((.((((...((((((.((((((((.....((.....(((((......)))))..))....)))))).))..)))))))))).)))).)))).))))))).)))...(((((........)).)))(((((((.((.((((....)))).))((((((.(((((((.(((((((.(((((((((((....((((((..........))))))))))).))))))..((((........))))....(((((((((..(((.(((((((((((((.((((..(((.......)))..)))).)...(((((((...((((((((((.((......)).))))...))))))..(((((((((((((((.((((((.((.((((((((((((....(((.(((.......(((........)))........))).)))..)).))).)))))....((..(((((....)))))..))((((((((.((((((..(((....(((....)))...)))..(.((.(((....(((.(((...))).)))...))).)).)....(((((((((.((.....))...((((((.((((.(((((....((((((((((((....(((((((.......)))).(((((((((((((((...((((((((((...(......)...)))))..((((((.((....)).))))))....((((((.........((((((((((...((((........))))(((((.........))))).............((((.....((.(((....))).)).....))))((.((((.(((...((.((......(((((((.((((......)))).))))))).......)).))..))).)))))))))))))))).....)))))).....(((.(((((.((((((((((.(((((...(((((((((((((.(((((((((((((.((.....((((((............((((....))))((....)).......(((((((((((...((.((((((.(((((.((((((((((.((.(((..((((...))))..(((........)))))).)))))))(((..(((((.(((((((.(((.((((..((((.........))))(((.....)))((((..((((...(((((((..(........)..)))))))))))..))))..((((.((((((((((..(((..(((((((((((((((((((.......((((((((((((((((..((.(((((...)).))).))..)))))).....))))).))))).)))))..))))))).)).(((.(..(((...((.(((((.(((.......(((..((((..((((..(((((((((((.((....(((((((...(((((((((((.(((((.((....)).))))).))))((((((....((((......))))...)))))).(.((((.(((((.........))))).)))).).)))))))..)))))))(((((((.(.((.(((....))))).))))))))((((((.((......)).)))))).....)).)))))))))))...))))......)))).)))..(((((((.((.((((...))))..)).)))).))))))))))).))))).).))))))))..))).......)))))))))).))))..)))).))).)))))))))))).)))..))))).))))))))))).))..)))))))))))...((((((((((....))))))).)))((((.((((((((((((((.((((......)))))))))))))((.(((((..(((...............)))...)))))..)).))..))).))))...((((((((....((....((((((((....)))))))).....((.(((((.....((((((((((.((((..(((((((.((((((......((((((((.((((((((.((((((((((..((.......((.....(((((....(((...))))))))...))......))..)))))))).....(((((((.(((((((((((((((.((.((((((((((......((((((((.((((((.(((((....((.((((........)))).)).))))).)))))).))))))))....((((.....(((.((.(((((..(((............)))..))))))))))....))))(((((..((.((.(((..(((..........)))..))))).))..))))).((((((((.........))))))..))...((((.(((.((((......))))))).))))...))))))))))....(((.(((.((((((........((((......))))(((((((((((...(((((((((...))))......)).)))....))))))))))))))))))))...)))..............)).))))))).)))))))).)))))))))))))))).).))))).)))............((((((.....(((..(((...)))...))).(((..........(((.((((....)))).)))..........)))..))))))...)))))).)))))))..............)))).)).)))))))).....))))).))(((((((((((((((.((((....(((((..(((............))).)))))...)))).))))))(((((........)))))(((....)))..((((...(((((.(((..(((....)))..))).)))))....))))(((((.....)))))....)))))))))..((((..........)))).....((((((.....))))))))....))))))))............)))))).)).)))).))))).(((......))).........)))))))))))))).(((((((.....))))))).((......))....))).))))).)))..))))..(((((((.((.(((((........)))))..)).)).))))).....))))))))))))))))))))..))))..))))))).....((((.(((...(((...)))...))))))).)))....)))))....))))))).....)))))..))))))...))))..(((((((((((((((((.(((((((((((((((((.((((((((((....))).(((((((......))))))).....................((((((.(((((....(((((((....)))))))(((((((.((((((((((((.....)))))..........))))))).)))))))(((..............))).....((((.......))))((((......(((((.(((((...........))))).))))).....)))))))))))))))...)))))))..)))))))(((....)))..(.((((((((.....)))))))).)......(((((((((((....)))))))))))......................))))))))))..))))).))))))))))))...)))))))))..........)))))).))))))))..(((((((((....((((((((((((((......((((........)))).((((((((.....(((((((((((((.((((..(((.(((...)))))))).))..)))))))))..........((((((((..(((((((.((((.((...(((...)))..)).)))).))))))).))))))))(((((((..(((((((....(((.((((.((...((((((((.............(((((((....))).))))..)))))))).....)).))))...)))))))))).(((((.....))))).((((((((((((((.(((((((.(((.......(((((((...))))..)))...))))))))))..)))))))))).))))..((((...)))).((......))..(((((.((.((((((..(((((.(((((((...((((..((((((((.(((.(((....((.((((((...((((........)))).)).))))...))...))).)))))))))))....)))).)))))))......((((...))))..............((((((((.....))))))))..))))).)))))).)).)))))..(((((((((((..(((.(((((((((((((((.(((..((((....)))))))))).....((((((((....((((..(((...(((((....))))))))...))))((((((....))))))...))))))))...)))))))).)))).)))..)).)).))))))).....)))))))..(((((((((((........................))))))))))).(((((((...))).))))))))))).)))))..((....))..)))))....))))))))).....)))))))))..)).))))).))).))))))))).))))))......((.((((((((...))))))))))((((....))))..................)))))))..(((((((...)))))))......(((...)))(((((((((..((((((((.......(((...((((((...))))))(((((....))))))))..(((...))))))))))).)))))...))))..))))))))))))..)))...(((........))).)))))))))((((..((.(((((...((((((.((((((((.(..........).)))))))).)))))).))))).))..)))).......(((((((.((....)).)))))))..............((((....)))))))))))...(((((((((......))))).))))))))))).))))))...........)))))))))))))))))).))(((((((.....)))))))......))))((((.((((((..(((((.(((((((..(((.(((((((((((((((((((((..(((((.((((((....((((.((((((((..(((((.....(((...((.((.(((.(((..(((.....(((((....((((((((....))))).)))...((((((((...))))))))((((((....))))))((((.....))))..((((((.((((...)))).)))))).(((....)))..(((....)))))))))))))).)))))...))..))).....)))))...))))))))))))..)))))))))))........(((........)))..(((....)))....)))).)))).........((((.(((.....))))))))))))))))).((((((..(((((((((.((((...(((((((.....))))))).((((..((..((((((((...)))))))).(((((...((((....)))).))))).......(((((.(.(((.....)))))))))))..))))...(((((..(..((.((((((....)))))).))..).....))))).........)))).)))).)))))......)))))))))..))))))))))..))))).))))))..)))))))))).....)))).)))).))))))))))......(((.(.(.(((((...........))))).).).)))((((.((((.((((...(((.(((((.((((((((.((..(((....)))..(((....)))(((((((((((((((((((....)))))))))((((......(.(.(((((((...(((((((.....)))))))......))))))).))......))))...........))))))))))....)))))))))).)))))..)))....))))..)))).))))(((((((((((((((((.((((((((......((((((((.(((..............)))..))))))))((((((.......))))))((.((((((((((((.(((((((..................(((((((((...((((...((.((..(((((.........(((((((((...(((.((((.((((........(((((.((.(((((((((((..((((((((......))).)))))..))))))))))).)).)))))............)))).)))).)))(((((((((((.((((.((.....)).))).).))))........)))))))......((.(((((.....))))))))))))))))........((((.....)))).(..(((((((......((((((......((.(((..((((.(((((..........(((...)))..((((...))))))))).))))..)))...))..)))))))))))))..).....)))))..))))...))))....))))))))).((.((((.((..........)).)))).))..........))))))).)))))))))))).)).....(((((((...(((.(((((((((((.(((.((((((((......(((((.((..(((((.........)))))..)).)).......)))............(((((((......))))))))))))))).))))))((((((.........)))))).(((..(((((((.(((((.((....)).)))))...)))))))....))).......(((......)))........(.((((((......(((....)))......)))))))((((((((((...))))).))))).........)))))))).))).))))))))))))))).)))).........(((...((((((.((((((...((((((((..((((........))))..)))))))).....((((.(((((((((...(((((((((((....((((((((((.((((((............(((((((.((.(((((((.....(((((.((.(((...))).)).)))))......))))).))..))....))))))))).))))..)))))))))).)))))))))...........((((.((((((.....((.........))......))))))))))((((((((((........((((...((((((((.......))))))))....)))).......((((......))))........))))).)))))((((.(((.(((((((.(........).))))))).))).))))................))..)))))))))..))))(((.(((((((((((.((..((((((((..((.((((((((.(((.......)))..))))...))))..)).)).)))))))).))))).))))))))))))))).))))))..)))..(((((((.....)))))))(((((..((((..(((((((((((...........(((((((.((((((..(((((.((....)).)))))..)))...........))))))))))........((.(((...((((.(((..(((((((....)))))))..)))))))..)))))..))))))).)))).))))..)))))((((((......))))))))))))..))))))).)))).)))).))))))).)))....(((((((((((.(((.(((.(((((.((..((......)).)).))))).))).)))...)))))....)))))).......(((((..........)))))))))))((((..((((((.....(((((..(((((..(((((((((((..(..(((((((....((((.(((((............(((((((..(((......))).)))))))))))).)))))))))))..)..)))....)).))))))..))).))........((((((....))))))((((((((...((((...(((((((((((...)))))))))))..((((....))))(((((((((.............)))))))))..))))))))))))(((((((((.....(((((...........))))).....((((......))))...)))))))))...........((((((((..((....)).))))))))....((((((((((.(((((.....))))))))....)))))))....(((......)))......((((((......)))).))...(((((((((((((((((((((((.((((....((..((((.........))))..)).....(((((............))))).....)))))))))).((..(((((......)))))..))..................)))))).))))))))))).........(((((.......(((.....)))......))))))))))..))))))...))))...........
Thermodynamic Ensemble Prediction
((((((((((((((((((((((((.(((((...)))))((((((((((((((.((((.,.((((((..{,{.{...,,,,.||||..{{||.(((((((((((((((,({,(((((({((((..,((({..,)))}))))((((.((((.((((...((((((,({((((((.....((.....(((((......)))))..))....)))))).))..)))))))))).)))).)))).||||}}},}}|...{{(((,..,,...}}.))}{|{{{{{|||}||||,,..}|||.,,((((((.(((((((.(((((((.((((((,((((.{{,{(((((..........))))))),)))}))))))..((((.,,,....}}||,,..(((((((((..(((.(((((((((((((,((((..(((.......)))..)))){|{{{(((({((.,.{{((((((((.((......)).))))..,)})))},,(((((((((((((((.((((((.((.(((((((((((({,..(({.,{|,......(((,,,....,|||,,......))),))}..,,.})),))))},.,,||,,(((({....}))))..,|((((((((.((((({..,{{,.,.(({.,{{}}}...}},..}}||.|||,.}}||(,(((,..}}}.))},,||},.|}{,{({{(((((((((.({.....,}...(((({,.((((.(((((....((((((((((({....(((((((.......)))).(((((((((((((((...((((((((((.{.{......)}..))))}..((((((.((....)).))))))..,.(({{{,....,....((((((((((,,,({{{........})))|{{(({{,......})))).....,,...{{.((((({........,...}))))).}}...,},,((.((((.(((...((.{,,{....(((((((.((((......)))).))))))),,....})}.)}..))).))))))))))))))))....,)))))).....((,,(((((.((((((((((.(((((.,.{,,((((((((((.(((((((((((((.((.....((((((.....,.,{...((((....)))),,..,}|}.......(((((((((((,{.((.((((((((((((.(((((((((,,((.(((..{{(({,.,,)),,(((........)))))).)))))))(((..(((({.(((((((.(((.(((({{({((....},..,)))|(((.....)))|,{|,.,(((..((((((((..(........)..)))))))),,)}}}}},..((((.(((((((((({,(((..(((({((((((((((((((.....,,(({{,(((((((((((.,((.(((,,...}}.})),))..))))))}....))))),))},,.)))))..))))))).)),(((.{..(({..,{{.{{(((.(((.......(((..((((..((((..(((((((((((.{,,...(((((((...(((((((((((,,{{{,.||,,,.}}.}}}}}.}}},((((((.,,.({((......})))..,)))))).(.((((.(((((.........))))}.)))).).}))))))..)))))))(((((((.(.(,{(({....})))).))))))))((((((.((......)).)))))).....}}.)))))))))))...))))......)))).)))..(((((((.((.((({...})))..)).)))).))))))))))),,}))).}.))))))))..))).,,....)))))))))).))))..)))).))).)))))))))))).)))..))))).))))))))))).)).})))))))))))...{(((((((((....))))))).))}((((.((((((((((((((.((((......)))))))))))))((.(((({..(((,......,,,.....)}),..}}))).,}}.|}.,))).))))...((((((((....((.{,,((((((({....}))))))},....{{,(((((...|,({((((((((.((((,.{((((((.((((({......((((((((.(((((((,,((((((((((.,({.......{(.,,,,(((((..........,)})))))...)}......},..)))))))).....(((((((.(((((((((((((((.((.((((((((((.(((..((((((((.((((({.(((((....((.{(((........)))}.)).))))).}))))).))))))))....{(((..,,.(((.,{.(((((..(((............)))..))))),}})).,..))))|{{(({,({.,{.{{{.,{||},}},.....,,,,.|||},.,},,}||||{((((((((.........)))))}..))...}}}}}{({{((((......)))))))....))).))))))))))...,(({.{{(.((({{{,,,.....{(((,.....},,.(((((((((((...(((((((((...))))......))},))....))))))))))),,|||}},....)))..}},,,}},,,,.)).))))))).)))))))).)))))))))))))))).).))))).)))...,,,,.,...{(((((.....(((..,,,...,}}...))).(((.,........(((.((({....}))).)))..........}}}..))))))...)))))).)))))))..............)))).)).)))))))|{{,..}||}}.||(((({{{{((((((((,,,...,{(,,,((({...,{{(({.,{{{{{...,|{|...,.((((....)))),|}}}..})})).),)}})}}}}}..,))))))))))}...||,}|,|||.,}},..))}}}}......,,,{((((((....})))))}...})))||}}}..{{{,....,,,.,.},},.....((((((.....)))))),}....))))))))........,}},)))))).)).)))).)))))},,{....,,}},.......,,)))))))))))))).(((((((.....))))))).((......))...,}.,.))))).)))}.,)}}..{((((((.((.(((((........)))))..)).)),})))}.....))))))))))))))))))))..))))..)))))))....,(((,,(((...,,,...))),,})),}}}}.)))....)))))....))))))).....))))).})}))},...))))..(((((((((((((((((.((((((((({{((({{{.{{{{{{,(((....))}.(((((((......)))))))..............,...,{.{{{{{{{((({(,,..(((((((....))))))){{||{({,((((((((({{{.....}}}}}|.........))))))}.}}}))))|{||,,.,|,..,|||.,,,,,,...,,,..,||..|||}((({......(((((.(((((...........))))).)))))..}..))))}))))}})))}.,,}}}}}}},,}}}}}}|{({....}}},.(.((((((((.....)))))))).)......(((((((((((....))))))))))),,,|,.,..,,,,},},.},,,,)))))))))..))))).)))))))))))).,.))))))))).,,.,,,,,.)))))).))))))))|,(((((((((...,((((((((((((((......(({{,.{,{{{.,|||.{{{{(({{,{({({,.,||{((((((,(((,..|||,{({{,,|}|||},,.}},.}))))}}))|||||||{{{{((((((({,{((((((.((((.({...{{,,,,})}..}).)))},))))))).(((({...})))).{{(,((((((((.....)))))))).}}|{{{((((,,,{(({{,....{{(((((....)))}}|}}..}})))})),,...,,,||||.,,},,,}}}}||,(((((,{{.{|||||.,{{{{||||||,,|}|{||{{{,||{....,,,|},(((,..,,}})..,|||,,||||}}}}}}|||}|||||}||{||||,{||||.,,|.,..,,.,,,..})}}|||||,||,||{|((,,{{{{{.(((((((..,((((..({{(((((,(((.{{{....{{.{|((|,.{{((((........)))},)).}))).,.)),..))).}))})}}}}}}|,..|}}}.|}}}}}),,,|..((((...))))......,,,|,...((((((((.....))))))))..))))),}}}))).)|,||}}}.,|||||||||||.{(((((((.((,(((((((,{(((,.(((,....)))))))))).....((((((((....{{{{..{,{...{((((,,,.}}}}))})},,))}}((((((....))))))...)))))))).,,||||||}}.}}}}||||{,}|.||,|||||||.....,))))}...||||||||||........}}}})})},........))))),))}})}||||||....))),))))}}))}))))))}},,}},,,,))}.))))},,})))))))}),.....))))))))).))}.))))).))).))))))))).))))))..||||||(((((((({...})))))))},((((....))))...,,,.................,||.(((((((...))))))).,....{{{...}}},{||(((({..((((((((.,,....||{...((((((...))))))(((((....)))))}},..({,...})})))))))).})))).,.,}}}..)))))))))))),,),,...(((........))).)))))))))||||..{{,|||{{.,,||{(((.((((((((.{,,.....},.}.)))))))).)))))).})))).))..))))}..,...(((((((.((....)).))))))).,{........,,,((((....)))))))))))...(((((((((......))))).))))))))))).))))))...,,}.....})))})}))))))))))).))||,||||..,,.|}||,,,...}},),}}((((.((((((..(((((.(((((((..(((.(((((((((((((((((((((.,(((((.((((((....((((.((((((((..(((((.....(((...,{.{(.(((.(((..(((.....(((((....((((((((....))))).)))...((((((((...))))))))((((((....))))))((((.....))))|.((((((.((((...)))).)))))),(((....)))..{((....))}))))))))))).)))))...},..))).,...)))))...))))))))))))..)))))}}}}}}......,,|||,.......}}}..{{,....,}}....))))}}))).........((((.(((.....))))))))))))))))).((((((..(((((((((.((((...(((((((.....))))))).,,,,||{{{.,(((({((,..)}}}}}||.(((((...((({....}))).))))).,,..|||{{,.,{.((({{{{,|||||||}|,,..,).)}..|||||..,..((.((((({....}))))).))......}}))))}...,,,,..)))).)))).)))))......)))))))))..))))))))))..))))).))))))..)))))))))).....)))).))))}})))))))))......(((.(.(.(((((...........))))).).).))){(({.((((.((((...(((.(((((.((((((((.((,.,,,,{{((.((((((....)))))).))))|,(((((((((....))))))))){(((......,.{.(((((((,..(((((((.....)))))))...,,,))))))),,,......}}},............,,,|||,,....,)))))))))).)))))..)))....))))..)))).}))|((((((((((((({{.(((((......|||{(((((..{((.(((....))).))}..)})))}}))(((((((((((((...(((((.((.(((..,..(((((((((.,,.............{{{{................(((.(((({(((((((({{(((........))}}.|.,(((.((((.((((....{,..(((((.((.{((((((((((,.((((((((......))).)))))..))))))))))).)).)))))......,,....)))).)))).)))|((({...,)}}||(.(((((({.,((((((((,(((.{({{{{,(((((((......,(((.,..}})|{||||((((((((((..(((((...{(((,,...|||},((,((((((((.(((,.{(((((.....)))).}}...,,..........{((.(((({,({{.(((((,....(((({.(((((((((.((((..({((((((((..(((((....(((.{......})))....))))))))))))}.((({..,|,|||,....,((({({(((((..((...(((((.{..{{..........,}....}))))...))..)))))))))),|},.(({(((,(((,(((((({(......|{{,,,}||}|,,||,,,,,|,,,||||,,..|,||..,,.,,|,..,}),.},.,..{{|||||}},...})))))})))))))).)))))}|||,,{......,,,||},,,.}},,,(((((((.(((((.({....}).)))))...))))))))))))))))))))}))))}}}}}))))))....))))))))))..)))))))}...}}.....(((((({.{{{{,,,,,,...,|||,.,,,,.......,.,)},}))))..,,.(((.....)))}|(((((........,)})))}|},|||..,,)))..,..((((((((..((((........))))..))))))))..)))))..))))))),}))(((((...((((((((.....(((((((......)))))))...(((((((.(({(((....))))).))))))).))))))))...)))))(((,,(({,.((((.....((....)}.....))))))))))).....,)})),.)))))))........,,,((((.((((((....,(,,........),,,....))))))))))((((((((((........,{{{...((((((((......,)))))))}.,..}}}}...||{.((((......)))),,,.....))))).)))))((((.(((.(((((((.,,.......}.))))))).))).)))).}||||}}.....,....,,...........((((((,{(((((((((((.((..((((((,(,.((.((((((((.(((.......))}..))))...))))..)).)).)))))))).))))).))))))))))))).)))))))))))))))},...)))))))))))))))....,,}..},},}))),||{{.....}}}}..,((((((,,(({{,,..(((((.({....}).}))))..,)),,,,,,.,,..))))))))))..{(((({(({..|||||||,..,,..|||||||}}}})))))),..,,},}.))).))))))....))).)).))))).))))))))))))).))))}.,)},}))))))}.,)))))),))))}}))).))))))).,,)})}}(((((((((((,(((.(((.(((((.((..((......)).)).))))).))).)))...)))))....)))))).....,{((((({,.,...,{{|}}},..,}))||||}}|{|,,,{{,.,..,,,,.{((({.,(((({{{{{((..(..(((((({...,((((.(((.({{{{{,......,,{{(((..{({......))).)})))))))))).)))))))))))..)..))},}}}}),)})))}..}||,||.......,((((((....))))))}|||,,||}}|{....,.(((((((((((...)))))))))))..{{{{.,..||}|(((((((((..,{{{..,{{{,||||,}}}}.{{.,,,)),,,.,,|||||||},....{{{{{,,,,..,,,,,))))).....((((......))))..,,}})))}|||||||,,,...((((((((..{{....}}.))))))))....(((((((((({(((({....,))))))))}..,})))))}....{{{......}}}......((((((......)))).))...(((((((((((((((((.,,,,..{((({,{{((..(({(.........)))).,}}.....{,(((,,.....,,.,,|}}},.....}))))))})}}||.|{{({{.....,})))),,},........,,)},,},,,)))))).))))))))))).{{{.(((((((({(((..(((({,.....}}.))))...)))))))))))))),,.,,})))..,}},.....

Transcripts

ID Sequence Length GC content
GUCAGUGAGCCUGGGGCCAGCGGGCGAGCCAGCGGCUCCGGCUCCCGCU… 8964 nt 0.4869
Summary

Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. This kinase has been reported to play roles in many different cellular processes, such as cell adhesion, cell transformation, cell cycle checkpoint, and cell volume control. Knockout studies in mice suggest that this kinase may be a fundamental regulator of cardiac contractility and Ca(2+) handling in myocytes. [provided by RefSeq, Jul 2008]

Forensic Context

A study in human post-mortem brain tissues demonstrated that the PRKCA mRNA level is down-regulated in chronic traumatic encephalopathy (CTE), CTE with Alzheimer's disease (CTE/AD), and Alzheimer's disease (AD) compared to normal subjects, as identified through transcriptome sequencing and differential expression analysis [Cho et al. DOI:10.1038/s41598-020-65916-y]. This down-regulation is part of a broader pattern involving memory function and long-term potentiation-related genes, including calcium/calmodulin-dependent protein kinase II and AMPA receptor subunits, which were commonly decreased in these head trauma-related neurodegenerative disorders.