Basic Information

Symbol
PRKCB
RNA class
mRNA
Alias
Protein Kinase C Beta PRKCB1 PKCB Protein Kinase C Beta Type EC 2.7.11.13 PKC-Beta PRKCB2 PKC-B Protein Kinase C, Beta 1 Polypeptide Protein Kinase C, Beta 1 Protein Kinase C, Beta EC 2.7.11 PKCI(2) PKCbeta PKCβ
Location (GRCh38)
Forensic tag(s)
Cause of death analysis Sudden cardiac death diagnosis

MANE select

Transcript ID
NM_002738.7
Sequence length
8010.0 nt
GC content
0.4625

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-2517.50 kcal/mol
Thermodynamic ensemble
Free energy: -2673.41 kcal/mol
Frequency: 0.0000
Diversity: 1920.97
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((((.(((((.((((((((((........).)))))))..))..)))))((((((.......(((((.......))))).))))))(((((((.((..((((((((.(((((((((.(((((.((((((((.....))))....(((((((((.(((((((((((((.(.((..(((....))).)).).))).)).))..)))))).))))))))).)))).).))))))).)))).))...(((((((((((((((....(((((....(((((..((((..((((..((.....................((((((((((.((((..((((...(((((((...)))))..)).......)))))))).))))))).)))...)).))))...)))).)))))....)))))....)))).))((((....(((((((((.((.(.((((((.((((((....)).))))....(((((..((.(((((((((....)))...((((((((.((..(((((.........))).))..))))))))))..))))))..))..)))))..)))))).).)))))))))))....))))..))).))))))..(((((.((((.....((.(((..(((.....)))..))).)))))).))))).))))))))..)).))))).))(((.........))).)))))(((((((((..(((.(((...........))).)))....))))(((((.((.(....(((((((...((....(((.....((.(((((((((((((.....(((((....((.(........).))...))))).(((.((.(((((((........))))))).......((((.....)))).....(((((....))))).)).))).))))))))))))).))......))).....)).....)))))))..).)).))))).(((((((...)))))))((((((((((.(((((((((((..(((.(((((..((((..(((...((((......))))(((((((((((..(((((((..((((.....(((.(((...)))...))).....))))((((((.(((((........((((..((..(......)..))....((((..(((...(((....))))))..)))).))))........))))).)))))).)))))))..))))((((........))))(((((.(((......)))))))).......)))))))..(((((((.(((((.(((..((((((.(((((((((((((.((((.(((((((...((((((((((.(((((...((((((((.((.((..(((...((((((.....))))))....)))..)))).))))))))...)))))((((((.(((.((((((.((((..((((((((..((......))))))))))..))))))..))))))).))))))..(..(((((((.((((.(((((((((((.((((((((.((((((.((((((((....(((((..((((((((.....(((...(........)...))))))))))).))))))))))))).)))..))).).))))))).))).))))))))...))....)).)))))))..).....(((...))))).)))))))).....))))(((.(((((.....((((((((((.((.((((.....)))))).))))))))))))))).((((.((((..........)))).)))).))).((((....))))..(((((((((.....)))))..))))))).)))).)))))))).((((...((((((((((((...(((......(((.((((.((.....)).)))).)))...((((((((....))))))))(((((......(((...((((....((((((((...(((.((((((.((((.((((((((((((((..((.(((...((((((((((......(((((((.....)))))))((((....(.((((((..((....)).)))))).)))))....(((((..........(((......)))..((((((((((....(((...(((((...(((((((...))))))).....))))).........((((((((((..((((((((((((.(((.((.........)).))).)))).).))..)))))...)))).))).)))(((((....)))))......(((......))).....)))....))))))))))..((((((((((.((((((((((..(((((((((((((((((((((((..((((((...)))))).((((((((((.((..............)).))))))))))(((((.......(((....)))............(((((((((....((...(((((......(((((((((((........))))))))))).....)))))...))...........((((..(((((.....)))))..))))))))).)))).............((((((.....))))))...((((((((((...(((((((((((((..(((((....)))))...........(((((.....)))))(((((((.(((((.((.............(((((((.....(((((......)))))...)))))))))..)))))...((((...))))(((((((((((..(...)..)))))))))))))))))))))...)))))))))))))))))))).......)))))(((((....((((.....))))...))).))........)))))))))))))...))))))))))........)))))...))))).))))))))))...(((((.....))))))))))..((((..(((((((((((((((.......))))))))..(((((....((((......)))).....)))))................(((.....(((((.....(((((........))))).....))))).....)))......((((((..(((((.(((...(((((.(((((.((...(((((((((((((.(((..(((((.((......)).)))))..))).)))))))))..))))(((((..(((.....)))..)))))......))))))))))))))))))))..))))))......(((....((.((((...)))).))....)))))))))).....)))).))))))))))....)))..))..)))))))))..))))).)))).......................((((.((.....)).))))..)))))).))).))))))))...))))...)))...)))))..((((((..(((((.(((((((((((((....((((..((((.((.(((........)))))))))))))((((.((((......))))))))(((((.......(((((((((((((((((((....(((((((......((((....)))).((((((....((((((((((((.....(((((((((((((((((..(.((.(((.....(((((......))))).....))).)))))))))).)))...........)))))))......)))))).).))))).....(((.((((....)))).)))(((((.....((((((((((((..........)))))).)))))))))))..)))))).(((((((((((((((..(((((((.((((((..((((..((((.(((((.......)))))....)))).))))))))))))))))).....(((((.............)))))....((((((((((((..((.(((((((.(((....))).)))))))))..)))))(((....)))..(((((((((..(((.((((((((((((((....(((((....((.(((((((.((....)).)))))))..))...)))))..)))))..........(((((((((.((......))..)))))))..))....))))))))).)))..(((.((((((((((((((.(((((.(((((.....(((((((((((((.(((((((..((((((((..((((((..((((((((((..........))))))...((((((((((...))))))))))(((((..((((((((.........(((((.((((.((((((...(((((((..(((((.(((((..(((.((((.......((((((.....((((..((..........))..)))).....))))))...........)))))))..)))))))))).......((((((....(((..((((((..............................(((((....((.((((((.(((((...((((((......((((((...(((((((.((((((.....(((((..........))))).....))))))...))))).))....))))))...................(((((((((............))))))))).......)))))).((((((.......))))))...))))))))))).))....)))))....(((......))).......(((((((((...((((....(((...((((((.((((((.......(((..((((((..............))))))..)))))))))..((((.((((.(((....)))))))))))..))))))...)))...........))))....))))))))).)))))).)))..))))))((((..((((.((((......))))..)))).))))....((((...))))..........(((((((((((.....(((((((..........)))))))..))))........)))))))))))))).....)))))).))))))))).(((..((((....))))..)))..(((((((............((((((..((((((((((..(.(((.......))))..))))).))))).))))))........)))))))...........(((((((((((.....)))).(((((.(((.(((((((........))).....)))).))).)))))))))))).(((....))).((((....)).)).((((((.....))))))))))))))..)))))...)))).))))))..))).(((((...)))))......(((((......)))))))))))))))))..))))..................(((.((((((((...))))..(((((..((((((.......)))))))))))))))...)))....(((((((((((((((((((((((((..............))))))))))))))))))))))))).......((((((((..(((((......(((.((............)).))).......)).)))..))))))))......)))))).))).))))).)))))..)))).....)))))))))).)))....(((..........)))...(((((((((((((......))))....)))).))))).........))))))...)))...))))))))))))))))))))))........))))))).....))))).))))))))).........)))))......))))).(((((....))))))))))))))).......))).))))).))))))..))).))))))))))))..)).))..((((....))))..............))).)))))))).((((((((((((((((.(((((((((..((((((((((((...((........))..))))...)))).)))).)))).((((.(((....))).))))........(((.((((((((.(((((((........)))))))((((....))))..........(((((........)))))..((((((((((((((((((....(((((((((((((((((............)))))))).))))))))).......(((..(((((((.(((((((.....((((((......((((((..(((.(((((((..(((((((((......((((.......))))...)))).....)))))..)).))))))))))))))..)))))).(((((...)))))))))).)).))))))))))(((((((...)))))))(((((..((((((((((((((((..((((((((.(((((.(((....)))..(((((((((.........((.....)).........)))))))))(((((((..((((...))))...))))))).....((((((.............))))))..((.((((((((((((((((..((((...(((.(......).)))...)))).))))))))..)))))))).)).......(((..(((((....))))).)))...)))))))))))))..))))).)).))))....)))))..)))))..........(((((((((((((((.((((((((....((((((...........)))))).....))..(((....((((..((.((...(((((....)))))...)).))..))))..))).((((((((((....))))))))))....)))))).)))))...))))))))))....(((......))).)))))))))).......(((......)))(((.(((((((((((((.((((....))))))))).....)))....)).))).))).................))))))))........................................................))))))))...)))...((......))........))))).)))))))............(((((((((((((........................)))))........))).))))))))..)))))).....))).))))).)))))))..)))..))))))))))))..))).))))))))..)))).)))))).....(((((((.((((((((((((((...((((...((((.(........)))))..)))).))))..))))))))))..........((..(((((((...(((......((.((........)))))))...)))))))..))........))))))))))))....((((((((.((((((((...(((((((((((.((((.((......)).)))))))))))............))))))))))))....))))).)))((((((((.(((((...((((((((((((((((((((.(((((((((((((((.(((((((((((.....((((.(((((...(.......)...))))).))))...)))))))))))..((.(((((...(((((...)))))))))).))..(((((((((..((........((((((((((.....(((((......((((((..((.......))..))))))..........(((((.(.(((((........)))))).))))))))))...))))...)))))).....))..))))))))).......))))))))).)))))).))............(((((((((.....)))))))))))))))))........))))))))))........((((((..((....))..)))))).))))).))))))))..
Thermodynamic Ensemble Prediction
((.((.((((.,{{{{{{((((........))))}}))))))).))))(((((((({{{.(((((.(((((((({((((({(.{{{..||{||||.{,.({({,|{|.||(((((((.(((({,((((((((.....))))....(((((((((.(((((((((((((.(.((..(((....))).)).).))).)).))..)))))).))))))))).)))).).))))))).)))).}}..|||||||||||||},,...)))||({{{.,||{...,,,.,))),,)}||,........{{(((((({..(((((((({{.{(((((((..,,...{((,{{{{.||||.{{({{{{{...,)))),,}))),..))}))).,,.)}),,..,,}},.)))))}}|},}}..,..)))))).))..})))))))},,,.})))))))),))))),|||....(((((.{........}))))){,{||||((((....))),..((((((((.((..{{(((......|,..}).)}..)})))))))).,))}))).,))..((((((......))))))..{(((.(((...{{...,)...))))))}.(((((.((((.,,..,(.(((..(((.....)))..))),)))))).))))).)))))))).{((((((((((((.....,(((,.((((((.......)))))).((((((((.((((....,{..,.......))..(((((.((.{....(((((((...((....(((....,{{.(((((((((((({.,,(,(((((....((.(........).))...))))).|}},...(((((((........))))))).,,,,.,((((.....}))).,...(((((....))))).,,.,,,.))))))))))))).}}......))).....}}.....)))))))..).)).))))).(((((((...))))))}((((((((((.((((((((,{{..(({.(((((,{(((({,{(((,(((.(((((.((.((((.,((..((....))..)).)))))).))))).)))})((((((((,.{({{(((((..(((((..{{.((({,(....))))){|,.,....,,|,.,,....,||||},,....,{|,||...{{(((.{(((.,,.(((..........))).,,,...((((((.,(((.(((.((((.((((.,({{(((({{{,{{{{{{((((.....}},.,}}||.,,|}}}.}).,.))))..},,}..(((.....)))((((((((.((((.(((((((...((((((((,{.{((((...((((((((.(,{((..(((..,((((((.....)))))),...)))..)))).))))))))...))))|((((((.(((.(((({({((((..((((((((..((,.....))))))))))..)))),}},))))))).))))))..(..(((((((.((((.(((((((((((.((((((((.((((((.((((((({...,(((((..(((((((({....,((............}...},))))))))).))))))))))))).)))..))).),})))))).))).))))))))...)),...}).)))))))..).....{{{...,}}}}})))))))).....)))){{(,(({{{.....((((((((((.{(,((((,...,)))))).))))))))))}))||.((((,(((,.........,}}}}.}))),))}.{(({....,)))}.(((((((((.....)))))..))))))).)))).)))))))).)))).)))).))),,,,..},,)))))))))).)))||{{{{..,,,,((((((((...((((((((((....)))))))},))((((.{({.((((...((((.{((...,{{{,,.,,((((((((((......)))))))))}.,{{|....,.,.|.....,,(({(,,.,((((((.....)))))))))}}..,,)))|.....,}}....))}...)))).)))).)}.,...)))).......{{(......))}.))))))))((((.((({....}))}.)))}((((((...)))))),.,,.((((,.{((((........))))),.)))),},.}}})}}},},.)))))..)))))))))))))))).....{(((,...||||..{({{,{(({((,,,,|,}}}..,}},,}}}.((((((((((((((.....{{((....}))}((((((((((.((((((((((..(((((((((((((((((((((((..((((((...)))))).((((((((((.{{,{...........})}.)))))))))).,,,,.......,{(....}},............(((((((((,...({...(((((...,,.(((((((((((........))))))))))).,,..)))))...)}...........((((..(((((.....)))))..))))))))}.)))).......,,....,,||{{,.,,,},.,))}..((((((((((...(((((((((((((..(((((....)))))..,,,,...,.(((((.....))))){{{||||.{((((.{..............(((((((..,{.(((((......))))).,,))))))},,..}||||....,,{...|||,(((((((((((..,...}..))))))))))))))}}))))},,.})))))))))))))))))))......,|||}|{,{{{....{{{{.....})))...))},,,........))))))))))))}..,))))))))))........))))))}}}}),}.))))))))))...(((((.....)))))((((((((.,,,,.{((({((.,...{{,,,{,{{||||||{{{.(((((.,,.((((......))))..,..))))).,}},...........(((,,...(((((,.,{,({(({.......,)}))),....))))).....}}}...,,.((((((..(((((.(((...(((((((((((.((,.{(((((((((((((.(((..(((((.((......)).)))))..))).)))))))))..))))|((((..(((.....)))..)))),....,.}}))))))))))))))))))..)))))).....{{{|.||||{{({{.,,,|},{(((((..((((((((.(((..((((((((.(({...{({{{.,..............})))))).))))))))..............((((((((((({{(..,,...,|,|{{{({,....,..(((((((((((..((((..((..,....((((((((((.({((({{{,{{{|||||{{{{......{{{(,{({(({({(,.,,,{{.|||}|||||(((((((({({(({{,{{,|}}|||||(((((((,..,,,}}}}}})|,||,||||.|,{{.{(((,,,...}|||,||,|,||||.}}.||||,,||||{}||{{..(((((((((((((.((((((((((..{.((.(((,,...(((((......)))))..,}.))).))))))))))},))..........,,,,,,|{{..{,,|||,}},},))||({{...|||,,|||...{||||.||||||{(({.{{{{.,,.(((((((((((.....(((((((((((((..........))))))))..)).)))....))))))))))),.,.,,,)))}.}}}}}{((((.......))))|(((((((((({....}))))))).))),}}}))}}}})..))}}}..,))))))).....(((((((({..,({....}},,)))))))))....})))}))}))}.))))}}))})}}...,|||}|||,}}}||.|||||||((,{(((,{{{((((({({.,({(((({{{.{{.,.,|},|||}|||...}}},)))}..}}))})},,}).}}}}}}{((((((.((......))..))))))}.,),,,,,))))})))).))}...(((((((((((.(((((((((,..{(((,.....,,}}}}{(((((...(((((((..((((((({..{{......}))))).))))..))).....)))).))))))))))).)))).))))..)))))))..{{..{||,,{|||,...)))).))),,))|||||,.{{{|,,,,..}))),))))))),,.....)))))))))).,,)).)))).)))))))))))......{{{(({{{......,,{{,((((,...}}}}.((((((.....))))))........((((((((((,(({.{,{{,.,...,,,......................(((((....((.((((((((((((,..(((((,...,,.((((((,{,((,(((({((((((.....(((((..........))))).....))))))...))))).)).}}.)))))).............{{{...(((((((((............)))))))))...,,,{||||{...,}}}}}}.....)))))..}.))))))))))).))....))))),,..((({,,...|||.,,..{{{{{{{|,,||((({((((,.,((,(({.{{{...{{||{,,,....((((((.....(((((((.{(.((((..,.(((((({(,{(((.(((..((((.(((((((((((((.(((((({,..,,,,...,,..,|,..,}}}..,...((((((.....}))))}....,{{,{,..((......||}})))}..,}}))}))|||,,.|||,.,{{((((...||,,......))..))))))))))))))))))),......}))))).))))..))))))}..........((((((((.(((.(((.((,{((((((((...((((((((((.((((..,,,{{,,.,(((((((............((((((..((((((((((..(.(((.......))))..))))).))))).})))))........)))))))....||||...(((((((((((.....}))).(((((.,(({(((({{{........}}}.....,)))}))).)))))))))))).(((....))).(((((({{{(,.((((((((.....)))))))).,},{{{{(((((......}}}}}}}({((((.{..,,.,,,{({,{.....(((((......)))))...((((((((((((((((({....{{(((({((((((......(((((..((((.{(((({..((((((.......))))))..,,.,,{{,.,,{,.,,,((((((((((((((((((((((((({{,...,}}.....))))))))))))))))))))))))}.........,{,(((((..(((.....)))..))},))..,,,......(((({{{((.((...(((((((..((((((.(((.,(({((............,((({(,,.,{(..(({{((((((......(((.,......}.)))...((((((((({(((......),}}....)))).)))))..))))))))).,|}...........(((((((({(((..((((.(((.((...(((....)))...)).))).))))...)))},})))))))..,||.,{,{((((........)))))))}}}}})),..,)))))....))).))))))..})),)))))).)))))))).......((((....))))...{{{{.......,,,.}))}.(((..(((((({..{{{..{{,.,,,||{{..({((((((((((...((.,......})}.))),..})))),)))).}}}},|{{|,|((....))|{|||,....,,.,|||,((({((((((((((((........)))))))........))))),,))),,,}{((((........)))))..,},)))))))..)))})))}}))))..))))),((((((............)))))))))))).))))))).....{((..{((((((.(((((((.....((((((||....,(((((..(((.(((((({..((((({{{{,.....((((.......))))...}))),.,..)))))..))}}))))))}))))))},}))))){({(({..,}}}},))))).)).))))))}}}}(((((((...))))))),))))).))))),})))}}})))..},}))}})})).|,})))}},))))))}},})})))...)))))))))))))))))),||,....,,,,.})}))).))).)))))))).(((....))).......)))))))).,)}}).))..))))))).,{.((((((((((((((((..((((...(((.{{....,).)))...)))).)))))))),.}))))))).||{{,({{{{,...}))))))))))).......}}))))),,,))),))}.))))))})))}.,{{({((({..{,||{|||,....,{(({{{((((((((((|{|{{|{({....((((((..........,))))))..,..))|.||{{,,.((((..{{.((...(((({....}))))...)).})..)))).,|,|{((((((((({....}))))))))}...,))})||{|||||(((((((,...,,))))))}....|{{{{...,,)))))}}.......})}}}))))))))))|,,,,,,,(((((.((((....)))))))))}}}}})))},,,}}.,,}}))}..))).})))))))))..|||,..,.............................................................}))},)))}..,||,,...,)}.,,,,,}},.))).))))))))))).))).)))))))).))))))....}}})))).))),)),.,,.,))))))))))))))).))))))).)))))))|||,||,,..,},)})},,}})))}})))),.})}})))))}))..)},.))))))))..)))).)))))).,,,.(((((((.(((((((((((.{,...((.((({((((.(........}))))})))).)).)}.))))))))))).......,,,{{..{{(((((,..(((.....,||,((........,}}})}|...}}}}}))..)}..}},...))))))).,,,....,..)))).)))))))).........(((((((.((((.((......)).}))))))))))..,,),)),)))))))))))},))...........(((((((((((((((((..((((((((((((((((((((.(((((((((((((((.(((((((((((....{{{((.{((((...{.......}...))))}.))))...)))))))))))..{{.(((((...((({{...)))))))))).}}..(((((((((..({........((((((((((.{{{,(((({......((((((..((.......))..))))))..........(((((.(.(((((........)))))).))))))))}))}.))))...)))))).....))..))))))))).......})))))))),}))))).))............(((((((((.....)))))))))))))))))........))))))))))..........,,.)))))))))}}.,{{,,....}})),))))))))..

Transcripts

ID Sequence Length GC content
GGACGAGCGGCAGCAGCUGGGCGAGUGACAGCCCCGGCUCCGCGCGCCG… 8010 nt 0.4625
GGACGAGCGGCAGCAGCUGGGCGAGUGACAGCCCCGGCUCCGCGCGCCG… 2707 nt 0.5054
Summary

Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. This protein kinase has been reported to be involved in many different cellular functions, such as B cell activation, apoptosis induction, endothelial cell proliferation, and intestinal sugar absorption. Studies in mice also suggest that this kinase may also regulate neuronal functions and correlate fear-induced conflict behavior after stress. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008] CIViC Summary for PRKCB Gene

Forensic Context

A study in human and Sprague-Dawley rat brain tissue demonstrated that the PRKCB was identified as a potential biomarker for death from mechanical asphyxia (DMA) through microarray screening and RT-qPCR validation, showing significantly reduced expression in the DMA group compared to craniocerebral injury and hemorrhagic shock controls [Hu et al. DOI:10.1016/J.Legalmed.2023.102382]. In a separate study using a Wistar rat model of post-infarction heart failure, the PRKCB was predicted as a target gene for multiple differentially expressed miRNAs and was found to be downregulated in the heart failure group [Liu et al. DOI:10.1371/journal.pone.0160920].