Basic Information

Symbol
PRKCE
RNA class
mRNA
Alias
Protein Kinase C Epsilon Protein Kinase C Epsilon Type NPKC-Epsilon EC 2.7.11.13 PKCE Protein Kinase C, Epsilon EC 2.7.11
Location (GRCh38)
Forensic tag(s)
-

MANE select

Transcript ID
NM_005400.3
Sequence length
5749.0 nt
GC content
0.4776

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1906.50 kcal/mol
Thermodynamic ensemble
Free energy: -2013.96 kcal/mol
Frequency: 0.0000
Diversity: 1557.79
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((((..((((((((...))))))).(((((.((...((((((....))))))))))))).(((((((..((((((...(((((.(((.((.(((......))))))))))))).(((.((((..(((.....)))..)))).))).((((((((((((((...((((((((((.((((.(((......)))))......))))))))))))((((((((((((..........((((.((............)).)))).....(((((......)))))..(((((....))))).(((((((.(.(((.(((((.....((((((......))))))(((((((((....)))))))).)......((((((((((((...)))))...)))))))))))).)))))))))))(((((((...((((.(((.((((((((...((...((((....))))..))(((((((((((((..(((....((((((((.(((((((..(((((.((...)).)))))((((...((..(((((...((((((((....)))))))).((...(((((((((((((...((((.....((............))..))))))))..((((....))))..)))))))))...)).........)))))..))..)))).....(((((((((...((((((((.....)))))))).((((((((((((((((((((..((.(((.(......).))).))..)))...)))))))))...((((....)))).....).))))).))((((...))))(((((..(((...((((...)))).....)))..)).)))((((((((((...)))))))))).((((......)))).))))).)))).))))))).)...)))))))....)))..)))))))))))))..........(((((........))))).))))))..)).))))))).))))))).....))))))))))))))))))........))))))))((((((((((((.((((((...(.(((.(((.........))).))).).........(((((((.((((.((.((((..(((((.(((.(((((((.......(((((..........)))))..........(((((....)))))))).)))).))).))))))))).)).)))).))))))).(((((.(((((...))))).)))))............))))))...)))).)))).))))))))))..)))))))(((((((((.((((.....((((......))))....(((((......)))))...............(((.(((((((.((((((((......((.(((..((......))..))).)).....(((((((((.((.(((((((((..(((((.((((((......((((.(((((((((.(((........(((.(((....)))..)))......))).)))).........))))).))))..(((((((..((.(((((..(((.....)))..))))))))))))))......(((((((((((((.((((..(((((((((((..(((((((((((......)))))).......)))))..)))).)).)))))..)))).))))((((...(((((((((..((((((....(((((((((...(((((.....)))))(((((((....)))))))...(((.....))).(((((.(((((((((..(((((.(((((.((((......)))).........................)))))))))).....))))))))).)))))((((((((....(((((..((((((.((.........(((((....(((....)))..(((((........)))))..))))))))))))).))))).....))))))))..)).)))))))...)))))).(((..........)))........(((((((....))))))).....((((((((.(((....)))...(((((.(((.(((........(((((.......)))))..(((((((((((((((((......((((((((........))))))))((((..(((((.....((((((.(((((((..(((((((((((.....((((((....((((.(((((((((..(((((.(.(((...(((((.((((.....).)))..)))))((((....)))).........))).).)))))...))))))))))))))))))).......((.((.(((.(.....((((((((......))).)))))).)))))))((((((....))))))....))))))))..((((....))))..(((((((.(((((.((((.(((((.((.(((((((.((((((....((.(((((...............(((((.....))))).....((((((((((......))))...((..((....))..)).......))))))..........((((((((((....)))))))))).....(((((((.((...(((..((......))..)))...)).))))))))))))))...)))))).(((.(((....((((......))))...))).))))).))))).)).))))).))))..))))))))))))))).))))))))))))).....(((......)))....))))).))))............(((((((.(((.((.((....)).)).)))..)))))))..((((((.((.((((......)))).))))))))((((....)))).(((((((..((....))))).))))....))))))).)))).(((((((((.(((....))).))))))))).....))))))....(((((((.(((....(((.(..((.((.((((..........)))).)).))..).))))))))))))))))))))))))..))))))))...((((.(((((.(((..((((((((.........))))))))...))).))))))))).)))))))))...))))((.(((((((((((((..(((((...((((..(((...((((((((((((((((.(((...(((..(..(((((.(((((((((....(((....)))..))))))).)).)))))..)..)))...(((((...(((.(((((.(((..((((((((((((((...)))))))))...(((((((((.....)))))))))......)))..))..)))))))))))...)))))...((((...(((((((....(((((((.....((((((((((.....((((.((((((((....(((((...(((...(((.(.((.(((((((..((((..(((.((((...((........)).)))))))))))...)))))).).))).)))...)))..(((((....))))).......((((((((((.(((((((((((((((.....(((..((..(((.(((((((((((((.(((..(((.(((.(((((((.......)))))))..(((((((.((((..(((((......)))))......((((.....))))..................(((((((.......))))))).....((((..(((((((((((...((((....((((((..((((((.((((((((((((((((((..(((((....)))))..))))))))((.(((((((((..(((....)))..))))))))).))((((...((((.(((....))).))))...))))..))))))).))).))))))..)))))).((((..((.((((((((................))))))))..))..))))...........(((......)))(((((((...))))))).......(((..(((.....)))..)))))))...))))...)))))))..))))(((((..((....))..))))))))))))))))...)))))).....))).)))))))))).))).))).))..)))((((((.....((.(((((((.(((.......(((((.(...((((((((((((....(((.(((.....))).)))))))))).))))).).))))))))))))))).))..))))))((((((((((((.((((((((((((((....((((((.((((((((((((((..(((((((((.(((((((((((.((.((((((......)))))))).))))))).)))).)))........))))))..))))).))))))))).))))))....((((.((....)).))))((((((..((((((((((((........)))))(((((((.((...)).)).))))).((((((((((.(((((.(((.....((.....))))).))))).))))....))))))..)))))))..))))))...(((((((.....))))))).....((((((((((............)))))))))).((((((.......))))))((((.(((((.....(((....))))))))))))...))))))............))))))))))))))))))))....)))))))))))..))))...))))))))))....).))))...))))))...))))))....))))))))))(((..(.((((((..................)))))).)..)))..)))))))..)))))))..))))(((..........)))....)))))))))))..))))((((((((((.((..(((((..(((((((((((..((.(((....))).)))))))))))))...))))).)).))))))...))))(((((.((........)).))))).....((((((.(((((.((((((((.....(((((...(((..((....))..)))....)))))))))))))..))))).))))))((((.....))))....((((.........))))(((((((...(((((..(((....(((((...(((....))).(((((.(((((((..(((....)))..)))))))))))).......)))))....)))..)))))...))))))).)))).)))..)))).)))))...))))))))))))).))........((((((((.(((.........................(((((((....)))))))..))).))))))))..)))))))))(((((((((.(((..(((((((.(((....))).)))))))..)))..))).)))))).......(((((((.((.(((....)))))))))))).((((((.......)))))))))))).....((((((.......)))))))))))..))))))))).)).)))).)))))..........))))))))))))))).))).........)))).).))))))))...)..)))))......((((((((.((((.....))))((((((....(((.(.((((..........)))).).)))....))))))))))))))........
Thermodynamic Ensemble Prediction
{{.,,,{{({(((((...|||||||{.,(({((((..(((,,({{{.||||||{,|||,..(((((((..((((((...(((((.(((.((.(((......))))))))))))).(((.((((..(((.....)))..)))).))).((((((((((((((,,.((((((((((.((((.(((......)))))......))))))))))))((((((((((((..,.,{.{{{((((.((.........,,.}}.))}}.....(((((......)))))..(((((....))))).(((((((.{.((({(((((,....((((((......)))))).|((({{((,,,,}}||||||.,{{,...((((((((((((...))))),..)))))))))}))})))})))))))|||||||.,|{{({,{{|,|||,||||,,.,,...((((....,|||,,||(((((((((((((..(((....((((((((.(((((((.,(((((.{{.,,||.||||||{((...((..(((({.,.{(((((((....)))))))|,(({{{((,{{{(((((({...||||.....{{.{........,.||..})}}}))}.,||||,,..)))).,||,|||||,...,}.,}}},.}.)))}),,)}..)))}.....|||{{{{{{...((((((((.....)))))))).,{{{((({(((((((((((((.((.(((.(......).))).))..)))),.,)))))))).,.{(((....))))..,..}.))})}.},((((...)))){{(((..(((...((({...}})),....)))..))},)}((((((((((...)))))))))).{{{{.....,)))).)))))))))}.))))))).)...)))))))....)))..)))))))))))))..........(((({........))))).}},}})}})}.,,,,,})}))))))}}}...)))))))))))),))))},....,,.))))))))((((((((((((.((((((.,,{.((({((,...{{{...})),},)}))}}......(((((((.((((.((.((({.{((({{,{{(,({{{{,({{{....||||(,,,,..{,,,|||||...,...,..(((((....})))},}}}))}}.})),)))}})))).)).)))).))))))).(((((.(((((...))))).))))).........},.))))))...)))).))))},)))))))))..)))))))||||({{{{|,,{{|..||{((,.....{|||{{{..(((((......)))))...............,}))||||,,..||,,,.(({.....))}||||}}|.}}}}.})).)))}))}}}}}|||||{{{,.||}|{,|||||,..{{{{{.,{||{{,,....((((.(((((||||.{{(........{{,.{({.,..,,|..|||{{....}}|{|||,...}}},,.})))).))))..(((((((..((.(((((..(((.....)))..))))))))))))))....{{(((((((((((((.((((..(((((((((((..(((({((((((......}))))).......}))))..)))).))}}})))..)))).)))}((((...(((((((((..((((((....((((((({(...(((((.....)))))(((((((....))))))),..(((.....))).(((((.(((((((((.,{((((.(((((.((((......))))........,,........,.,}...})))))))))}....))))))))).)))))((((((((....{((((..((((((.(({...,{{.,{((,((((.(((....)))..))))|}.,.,...|||}}..,)}}))))))))).))))}.....)))))))),,)),)))))))...)))))).,(({{{{.,,...,||........(((((((....))))))).....((((((((.{{{....))}...(((({{(({{((({....({{(({{({{....,)))},}}}}},(((({{,,,,.,,,,.,..((((((((,{...,,.)))))))}((((..(((((.....((((((.(((((((..(((((((((((.....((((((,...((({{(((((((((.,(((({,((({(...(((((.((({.....}.)))..))))){{|{....}}}|.,,....,,))).))))))).,.)))))))))))))))))))....,.{{{.,,.,||,|....{(((({{((......)))})),)),.})}},|,{(((((....)))))),...))))))))..((({....))))..(((((((.(((((.((((.(((((.((.(((((((.((((((....{{.({{{,.........,{....(((((.....))))).....}}}|,.((((......))))...,,..,{.,}|)}.,{{.,,..,,}}...||{,.,,....((((((((({....})))))))))....,(((((((.((...(((..((......))..)))...)).))))))))))})))}..)))))).(((.(((....((((......))))...))).))))).))))).)).))))).))))..))))))))))))))).))))))))))))).....(((......)))....))))).}}}),,,..,}}},,,(((((((,,{{{{{{{{,,..,}}}}})},..}))))))..{((({(,((,{{{|,,,,.,))}}.}))))}}}{(((,,,,|}|}.{((((((..((....)))))}}))}...|}||}))),,,}|}(((((((({.{{{.,,.|||,|||}}}}}}.,}}}}),}},....{(((({{((((,...(((.(,.((.((.((((..........)))).)).)),,,.))))))))))))))))))))))))..)))))))).}}||||{((((({(((..((((((((.......,.))))))))...}},.,,))))))),)))))))))...))))((.(((((((((((((..(((((...((((..(((...((((({{{(({{(({{.{((,,.(((..,..{{{((,{((((((((....(((....)))..))))))).}}.}}|||,,|{{}}}.,{((((({{,(,.{(((((.{((..{{{{{(((((((((...))))))))}...(((((((((.....))))))))).....,}}}..}}..}}}})))))}},,,||}||,,.{|||||}|{(((({,,,.{{{{{((,..{{((((((((((.....({((,((((((((..|,((((,..,(((...(((.{.{{.,((((((,.,(((,.((({((((...((........)).))))))})))),)})))))).}.))}.)))...)))|.(((((....))}))}......((((((((((.(((((((((((((((.....(((..((..(((.(((((((((((((.(((,.{,{{(({,(((((((.......)))))))..,,,,,.{{(({{{,.((((.||,{.|||||,......,,,,...{{{({..{{{{.{{{........(((((((.......))))))),}}.}|||,.}}|}}{{{,,{{{,,{(({,||{((((((.,((((((.((((((((((((((((((..(((((....)))))..))))))))((.((({{((((..(((....)))..))))}}))).))((((...((((.(((....))).))))...))))..))))))).))).)))))),,)))))}.||||.}||}||||||||||{|,,|,|,||,.}||||||}|}..}}..})))......,||,.{{{...,,,}}}(((((((...))))))).,}}},.|||}}|||,,,..)))}})))....}}}}}||||,||.|||||||({((((({,.({....,)..))}},)))),}}}|}|||.,,,,}}....,))),)))))))))).))).))).))..))),.,,,,..,..((.(((((({{({{.......(((((.(...((((((((((((....(({.(({.....))}.}}})))))))},)))).).)))))}}}))))))).))..,}}}|}{((((((((((({{((((((({{((({{{,.{{{|||.{{(((((({(((({.,(((((((((.(((((((((((.((.((((((......)))))))).))))))).)))}.)))........)))))).,))))).))))))))).||||||,,..{{{||||,,,,}},}||(((((((..((((((({((((........}))}}(((((((.({...}}.})}})))).(({(((((((.(((((.(((.....((....,||))).))))).))))....))))))..)))))))..))))))},.(((((((.....)))))))..,,,{((({{,{(({(((.......))))))))))}.{{{{{{.,,.,,,|||,,|,{{,,{((((|{{{,{,|,,,,},,}}}})))})}}}}}}))),,..........)))))))))))))))))))),,..)))))))))))..))))...))))))))))....}.}}}},..)))))}...))))))....))))))))))}|{..{.{{{{{{...,,.,,.......,,,)))))),)..}},..)))))))..))))))}},}}},|||..,,,,,,,||||||..||}|||||||{......,,..((((((.((.,(((((..(((((((((({.,((.(((....))).))))))))))))),..))))).)).))))))}}}))))}||{{.||,.......,}.)))),...||((((({.(((((.((((((((,,.,,(((((...{((|.,....,||{.}}}...,)))))))))))))..))))).})))))((((.....))))....((((,.....,,,)))){((((((...((((({{(((,.{,(((({.,.{{(....,||.((({({(((((((..{{,....)))..)))))))}))}),}.},,,)))))....))},,)))))}}})))))))))))).)))..)))).)))))...))))))))))))).))........{(((((((.{{{...........,,,....{{{{{{.(((((((....)))))))}})))})))))))).,))))))))|(((((((((.(((..(((((((.(((....))).)))))))..)))..)))}}))))),......(((((({,((.(({....}))))))))))).{(..(({{{{{{,||||,.,,,||.....,|{{{{,{,{{{{,||,,|||||,,..,,}})))}}.)),)}}),)),)),}}})))))}..)))}|)))))}))}}},.........,}})})}}))))..|{{{|..,,,,)}}},..(((((((({((({.....}}}},(((((.,..(((.(.((((..........)))).).)))....}}))))))))))))...,,...

Transcripts

ID Sequence Length GC content
GAAAUUUCCCGGGAUUAUGUUUCGGAAAGGUAGGUAAGCGCCGGGCGCG… 5749 nt 0.4776
Summary

Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. This kinase has been shown to be involved in many different cellular functions, such as neuron channel activation, apoptosis, cardioprotection from ischemia, heat shock response, as well as insulin exocytosis. Knockout studies in mice suggest that this kinase is important for lipopolysaccharide (LPS)-mediated signaling in activated macrophages and may also play a role in controlling anxiety-like behavior. [provided by RefSeq, Jul 2008]

Forensic Context

No relevant information is available at the moment.